a potential role for diagnostics

... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... O-acyltransferase-1 (SOAT-1) using FCs and free fatty acids (FFAs) ABCA1, ATP-binding cassette, subfamily A [ABC1] member 1; ACAT, acyl-coenzyme A: cholesterol acyltransferase; ApoE, apolipoprotein ... primarily the pathophysiological and biochemical abnormalities that subsequently result in the activation of the autoimmune attack against the submandibular and lacrimal glands [10], is a single...

Ngày tải lên: 09/08/2014, 13:22

... Ishikawa M, Ishiwata K, Ishii K, Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after ... sigma-1 receptors in the efficacy of fluvoxamine for akathisia Author details Department of Psychiatry, Asahikawa Red Cross Hospital, Asahikawa, Japan Division of Clinical Neuroscience, Chiba University ... Cite this article as: Furuse and Hashimoto: Fluvoxamine for aripiprazoleassociated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors Annals of General Psychiatry 2010...

Ngày tải lên: 08/08/2014, 23:21

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...

Ngày tải lên: 03/11/2012, 10:52

... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both official languages Les...

Ngày tải lên: 16/02/2014, 02:20

... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...

Ngày tải lên: 19/02/2014, 05:20

... and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA ... ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature forms of Toc75 in a ... apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical punctuation marks in protein structures: glycine and...

Ngày tải lên: 19/02/2014, 07:20

... Lanka, Thailand, and Vietnam »  estination Country Participants: Bahrain, Italy, Kuwait, Malaysia, Qatar, D Republic of Korea, Saudi Arabia, and United Arab Emirates In January 2008, the Abu Dhabi ... Saudi Arabia 383,031 United Arab Emirates 18,551 Egypt Unknown Jordan 16,821 Malaysia 85,835 Oman 31,317 Qatar Unknown Saudi Arabia 114,981 United Arab Emirates 6,443 Jordan Malaysia Pakistan ... available in villages and towns » Make the passport and visa application process more straightforward South-South Labor Migration Flows Jordan Egypt Kuwait Saudi Arabia Qatar U .A. E Pakistan India...

Ngày tải lên: 15/03/2014, 21:20

... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... gyrans (B), Laminria japonica (C) and Undaria pinnatifida (D) with antibodies raised against various extrinsic proteins Lane 1, anti-(H-PsbP); lane 2, anti-(H-PsbQ); lane 3, anti-(G-PsbQ); lane...

Ngày tải lên: 23/03/2014, 15:21

... Laemlli sample buffer and proteins were quantitated by Bradford reagent (Bio-Rad, Hercules, CA) After heating for at 95°C, proteins were separated by SDS-PAGE on 12% polyacrylamide gel and transferred ... in organic media For peroxidase immunohistochemistry, a standard two-step Dako Autostainer (Dako Corporation, Carpenteria, CA) was utilized to examine the thymic sections An antigen retrieval procedure ... phosphorimager (Molecular Dynamics Storm, Sunnyvale, CA) at a resolution of 50 μm Grid overlays were utilized to identify cDNA targets on the arrays and signal intensity for each cDNA was examined...

Ngày tải lên: 08/08/2014, 18:20

... severe forms of anorexia nervosa Upon primary medical stabilization, patients are transferred to a psychiatrically based inpatient eating disorder program further treatment and follow-up Patients and ... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively...

Ngày tải lên: 09/08/2014, 01:21

... instructions Anticollagen antibody assay Sera were collected from control DBA-lpr/+ and mutant DBA-lpr/lpr mice before immunization and at days 20 and 47 after immunization and a standard ELISA was used ... original inbred strains Arthritis Rheum 2002, 46:1067-1074 Sugiyama M, Tsukazaki T, Yonekura A, Matsuzaki S, Yamashita S, Iwasaki K: Localization of apoptosis and expression of apoptosis related ... 93:1029-1034 Amasaki Y, Kobayashi S, Takeda T, Ogura N, Jodo S, Nakabayashi T, Tsutsumi A, Fujisaku A, Koike T: Up-regulated expression of Fas antigen (CD95) by peripheral naive and memory T...

Ngày tải lên: 09/08/2014, 01:23

... UK) Statistical analysis All data were expressed as the mean of the individual experiments ± the standard error of the mean Data were analysed using one-way or two-way analysis of variance with ... Capell HA, Sattar N: Trial of Atorvastatin in Rheumatoid Arthritis (TARA): double-blind, randomised placebo-controlled trial Lancet 2004, 363:2015-2021 Palmer G, Chobaz V, Talabot-Ayer D, Taylor ... tissue factor procoagulant activity J Exp Med 1997, 185:1619-1627 36 Collard CD, Agah A, Reenstra W, Buras J, Stahl GL: Endothelial nuclear factor-kappaB translocation and vascular cell adhesion...

Ngày tải lên: 09/08/2014, 08:22

... sedimentation rate, and the patient global assessment of disease activity (100 mm visual analogue scale) [15] Cardiovascular risk factor ascertainment CV risk factors were ascertained among RA patients ... first maximum slope of the change in signal for the near and far walls, and repeating the analysis to identify the media–adventitia interface The software calculates the mean and standard deviation ... Statistical analysis Continuous variables are described as the mean ± standard deviation, and categorical variables presented as the percentage Log transformations were applied to non-normally...

Ngày tải lên: 09/08/2014, 10:21

... Statistical analysis Data were analysed using GraphPad Prism 4.03 (GraphPad Software, San Diego, CA, USA) For CIA experiments, analysis of different treatments was carried out with a two-way analysis ... untreated (as indicated for the relevant experiments) (a) Clinical score was assessed over weeks Data are expressed mean ± standard error Statistical analysis was carried out using a two-way analysis ... treatment with TNP-470/ AGM-1470 in a transgenic mouse model of rheumatoid arthritis Arthritis Rheum 2000, 43:2056-2063 36 Nagashima M, Tanaka H, Takahashi H, Tachihara A, Tanaka K, Ishiwata T,...

Ngày tải lên: 09/08/2014, 10:22

... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification ... participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel ... thermal imaging of the wrist and MCP, normal adult wrists and hands from controls were imaged on separate days Three thermal scans were obtained at each session and the HDI was calculated for each...

Ngày tải lên: 09/08/2014, 10:22

... Materials and methods Gene datasets TCGA Data were obtained from The Cancer Genome Atlas (TCGA) database This dataset comprises of molecular characterizations from 373 GBM patients For each patient, ... state, and (iii) of the complementary event Survival analysis Kaplan-Meier survival analysis was done on all pathway measurements in all five datasets [21], through clinical data (Vital Status) ... scores (a score for each pathway in the database) to each sample in every dataset Network information has been obtained from The National Cancer Institute's Pathway Interaction Database (PID) [12]...

Ngày tải lên: 11/08/2014, 12:21

... performed in primary human astrocytes and astrocytes cell line(U87-MG human glioma cell line) Astrocytes are highly abundant in the brain and play a vital role by providing the metabolic and ... Pradhan L, Ali M, Agrawal KC: HAART drugs induce oxidative stress in human endothelial cells and increase endothelial recruitment of mononuclear cells: exacerbation by inflammatory cytokines and ... cytokines and amelioration by antioxidants Cardiovasc Toxicol 2004, 4:287-302 Gomez-Vera J, de Alarcon A, Jimenez-Mejias ME, Acosta D, Prados D, Viciana P: Hyperglycemia associated with protease inhibitors...

Ngày tải lên: 12/08/2014, 04:20

... years Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded ... Medial compartment Annual change in cartilage volume Cartilage defects progress vs no change Lateral compartment Annual change in cartilage volume Cartilage defects progress vs no change Annual ... coefficients of variation for the medial and lateral tibial cartilage volume measures were 3.4% and 2.0% respectively [35,36] Annual change in cartilage volume was calculated as follow up cartilage volume...

Ngày tải lên: 12/08/2014, 11:22

... statistical and data analysis, interpretation of data, and drafting of the manuscript WBvdB conceived of the study and helped draft the manuscript All authors read and approved the final manuscript ... 5'-TCTAGAGATCCGACGCCGCCATCTCTA-3' and reverse 5'-GTCGACGTTAACAAGGCTTTTCTCCA-3' The target sequence for silencing the Tnfrsf 1a gene [EMBL:M60468] was ATCTTCGGTCCTAGTAACT (base pairs 1095 to 1113), and we used ACTCATGTCTTGATCAGCT ... of TNFR1 may be a promising and safer approach for TNFα blockade in RA patients Page 10 of 11 Additional material Additional file Supplemental Methods Primerdesign Abbreviations APC: antigen-presenting...

Ngày tải lên: 12/08/2014, 12:20

... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... AGGCAGTCCGTAACATCCAC, Reverse; CTTCAGTCCGTAACATCCAC) and STIM2 (Forward; TCCCTGCATGTCACTGAGTC, Reverse; GGGAAGTGTCGTTCCTTTGA) Cycling was performed 35 times; 94°C, followed by 55°C (annealing temperature),...

Ngày tải lên: 12/08/2014, 16:20