which play a deciding role in the phagocytosis process
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
Ngày tải lên :
07/03/2014, 16:20
... pTorA/P2 [ 17] a s a template and the primers
RRTorA-SacI-fw (5¢-GCGCG
GAGCTCAAGAAGGA
AGAAAAATAATGAAC-3¢, SacI site underlined) and
TorA/Lep2-BamHI-rv (5¢-GCAT
GGATCCCGCGCGC
TTGATGTAATC-3¢, BamHI site ... (5¢-ACTG
ATCGATCTAGATTACGCAT
AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG
GTACCGGATTGACCAAC- 3¢, ClaI site underlined,
XbaI site in italics, HA-epito pe sequence in boldface). The
resulting fragments were cloned into ... post-translational targeting/trans-
location pathway t hat operates i ndependently of the Sec
pathway (reviewed in [11]). In contrast to the Sec pathway,
the Tat pathway has the striking a bility...
- 9
- 393
- 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
Ngày tải lên :
16/03/2014, 04:20
... FAD49 lacking its PX domain (GFP–SH3),
individual DNA fragments encoding full-length FAD49
(amino acids 1–910), the FAD49 PX domain (amino acids
1–130) and FAD49 lacking the PX domain (amino acids
126–910) ... initiation
(A/ GCC
ATGA/G). A 1809 bp cDNA fragment con-
taining a stop codon was isolated by RT-PCR. A
1007 bp cDNA containing a poly (A) tail was obtained
by 3¢ RACE. By combining these cDNA fragments,
fad49 ... control.
The PXXP motif was found in the FAD49 PX
domain, as in many PX domains, suggesting that the
PX domain could bind to an SH3 domain of FAD49.
To test whether the PX domain could interact with an
SH3...
- 13
- 385
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
Ngày tải lên :
16/03/2014, 16:20
... for the PA–substrate inter-
actions in the transition state are missing and only a
GRID
computational modelling approach to the tetrahedral inter-
mediate in PA presents some indications of the ... substrates docked in the active site of penicillin acylase by AM1 calculations. Amino acid residues of
the enzyme are at their X-ray coordinates [19]. Substrates having local symmetry of the leaving ... could be involved both in catalysis and
productive binding.
Graphic simulation of the interactions of arylamide
substrates with the nucleophile binding subsite of PA
indicates that the arylamide...
- 8
- 438
- 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
Ngày tải lên :
23/03/2014, 15:20
... correlated with the chain length of
interacting polyamines [24–27] and (c) that a trans-
ition of the DNA chain from a dispersed coil state
to a condensed-collapsed state parallels an increase
in ... is
the charge attraction between DNA phosphates and
the amino groups of polyamines. As the amino groups
of polyamines are already engaged in ionic bonds with
the phosphates of NAPs, secondary amino ... Poly-
amine-stimulated binding of diamine oxidase to DNA.
Acta Chem Scand 52, 921–929.
36 D’Agostino L, D’Argenio G, Ciacci C, Daniele B,
Macchia V & Mazzacca G (1984) Diamine oxidase in
rat...
- 11
- 380
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
Ngày tải lên :
31/03/2014, 01:20
... decreasing
TNF -a mRNA levels in MonoMac-6 cells. Taken together,
the data from these studies suggest that LPCAT is a key
enzyme in both the pathways of activation (priming) and the
in ammatory ... of the
cell walls of Gram-negative bacteria, is an important
microbial molecular pattern that initiates in ammatory
and coagulation reactions as part of the host innate immune
response to infection. ... plate was incubated in the dark for
20 min and the reaction stopped by the addition of 50 lLof
0.5
M
sulfuric acid. The plate was read on a Labsystems
Multiskan plate reader using the absorbance...
- 7
- 322
- 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
Ngày tải lên :
18/02/2014, 04:20
... Chalfont, UK).
Statistical analysis
Statistical analysis was performed using the graphpad
prism, version 5 (GraphPad Software, Inc., San Diego, CA,
USA). Statistical significance was calculated ... GRASP55 and TGF-aD152 (lacking the last
eight amino acids of the ICD) compared to the TGF -a
D158 construct lacking only the last two valine resi-
dues, suggesting a role for an internal motif in ... expression of a catalytically
inactive dominant negative furin construct affected the
processing of pro-MT1-MMP. Taken together, these
data reveal a new cellular function for GRASP55 as a
molecular bridge...
- 18
- 603
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
Ngày tải lên :
18/02/2014, 17:20
... 5¢-gagagattt
gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct
accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg
ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa
ctttgaatgggcggagggttatattgag-3¢. ... corresponding to
the sense strand are listed, as follows: mutation E19 0A,
5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa
cgagcctagacagatttgctttgagg-3¢; mutation E19 4A, 5¢-gagagattt
gctttgcgggttatggatctgc-3¢; ... delineates a channel that could be
the pathway for the release of the aglycone in the glyco-
sylation step and the entrance of the water molecule
involved in the hydrolysis of the covalent intermediate
[17]....
- 12
- 731
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
Ngày tải lên :
21/02/2014, 01:21
... soy arabinogalactan consists of 57%
D
-galactose and 38%
L
-arabinose. Methylation analysis
demonstrated that a substantial amount of the
L
-arabinose
residues (14%) in soy arabinogalactan is ... can
be substituted with a) 1-,3-linked
L
-arabinofuranose chains.
Type I arabinogalactan is degraded by b-1,4-endogalacta-
nase and b-galactosidase. b-1,4-Endogalactanases cleave
within the galactan ... thank Simon Flitter for the identification and isolation
of the galA containing phage clones and Matthew Illsley for the
analysis of a-
L
-1,5-arabinofuranosidase activity in the endogalactanase
preparation.
REFERENCES
1....
- 9
- 669
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
Ngày tải lên :
08/03/2014, 23:20
... Finally, reducing transport offers some additional,
if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking)
and a significant body of literature has ... to average approximately 80 and
90%, respectively of that in conventional dairy farming.
Thomassen et al. [60] in the Netherlands conducted a detailed ‗cradle-to-farm-gate‘ LCA analysis,
including ... those of the stakeholders involved in the survey, namely
the Organic Agriculture Centre of Canada, the Organic Value Chain Roundtable and Agriculture and
Agri-Food Canada.
References and Notes...
- 41
- 524
- 1
Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot
Ngày tải lên :
18/03/2014, 01:20
... 5¢-ATCTGATAACAC
AGCCCACTCAAGTAT-3¢; C46 6A( sense) 5¢-GATAAA
GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense)
5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢;
C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT
AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG
GCTTTGCTCTCTG-3¢.
PCRs ... result in a conformational change within
the receptor chain enabling the activating interaction with
the LIFR. Another explanation is that of an intermolecular
bond between gp130C458Ac and the LIFR. ... FNIII domains of gp130 are therefore assumed to
be arranged in such a way that the C-terminal parts of the
membrane-proximal domain D6 are positioned in close
vicinity to each other. In analogy,...
- 11
- 583
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
Ngày tải lên :
31/03/2014, 15:20
... resistance against the
acidic autoxidation in a manner of contacting with the a
chain, no matter which valency state t he latter partner is in,
the ferrous or the ferric. These new ®ndings have led ... a1 b2anda2b1 contacts undergo the principal changes
associated with the cooperative oxygen binding, so that
these are named the sliding contacts. At the a1 b1anda2b2
interfaces, on the other hand, negligible ... These
were taken as an indication that the H
e2
proton is stabilized
against solvent water exchange by a hydrogen bond between
the distal His and the O
2
ligand in both a and b chains. At
the same t...
- 10
- 648
- 0
Natural botanical products have a long history in the world and are featured in using a complex
Ngày tải lên :
03/11/2012, 09:54
... treatment groups. They were fed intragastrically (i.g.) daily for 14 and 28 days.
Tumor areas were measured every 7 days using a caliper, and the tumor area was calculated
according to the ... expressed as the number of apoptotic cells per field.
Statistical analysis
Statistical significance between the treatment groups was analyzed using a two-way statistical
analysis of variance (ANOVA), ... Research, and
the Gastrointestinal Pharmacology Section of International Union of Pharmacology. He serves on the editorial
board of several journals such as European Journal of Pharmacology, Journal...
- 9
- 712
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
Ngày tải lên :
03/11/2012, 10:52
... IgG, Santa Cruz Biotech,
CA). The assay was developed using a stabilized HRP
substrate. All samples were analyzed in the linear
range of the ELISA using over-expressed human Vgf
as a standard. ... Acad Sci
USA 2006; 103(39): 14584-14589.
16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H,
Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T,
Nakazato M, Minamino N. Peptidomic ... and the recombinant
virus was packaged by infecting the PacI linearized
recombinant viral DNA into human embryonic kidney
(HEK)-293 cells (Clontech, CA). The resulting recom-
binant virus was...
- 8
- 499
- 0
- we are seeing a global increase in the prevalence of agerelated disorders
- the role of the courts in the criminal process begins with the
- what is a toucans habitat in the rainforest
- what is a gorillas habitat in the rainforest
- what is a jaguars habitat in the rainforest
- what is a plant adaptation in the rainforest
- the us federal reserve plays a critical role in
- what is a plant adaptation in the tropical rainforest
- there a gold mine in the sky lyrics
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2