... that both Arabidopsis cohesin (AtRAD21.1 and AtRAD21.3) play a role in somatic DNA dsb repair Furthermore, the phenotypical data from the atrad21.1 atrad21.3 double mutant indicates that these two ... standard deviation Quantitative RT-PCR data is available in Additional file 1: Table S2 variation, after the induction of DNA dsb damage, is not identical AtRAD21.3, in association with AtRAD21.1, ... for each time point The relative transcript content was calculated using Actin2 and AtEF1? ?A4 as the reference genes, and normalized against the non-irradiated sample The error bars represent the
Ngày tải lên: 27/05/2020, 00:44
... TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA 3' 5' GCC GGG ACA CAC GGA GTA 3' 99.74% ADAMTS ... the aging and degenerating intervertebral disc: immunolocalization of senescence-associated beta-galactosidase in human and sand rat discs Spine 2007, 32:321-327 Martin JA, Buckwalter JA: Aging, ... specimens A block of tissue (incorporating AF and NP in continuity) was fixed in 10% neutral buffered formalin and processed to paraffin wax Sections were taken for haematoxylin and eosin staining
Ngày tải lên: 09/08/2014, 10:20
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi H: Vacuolar sulfate transporters are essential determinants controlling internal ... Takahashi H, Watanabe-Takahashi A, Smith FW, Blake-Kalff M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis ... their vital roles in sustaining growth, and their participation in related metabolic pathways, plants have e volved coordinated and tightly controlled mechanisms to maint ain intrac el- lular s ulfur
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx
... Nakano K, Okada Y, Saito K, Tanikawa R, Sawamukai N, Sasaguri Y, Kohro T, Wada Y, Kodama T, Tanaka Y: Rheumatoid synovial endothelial cells produce macrophage colony-stimulating factor leading ... suggesting that tyrosine kinases are important in the pathogenesis of RA Indeed, we and others have shown that imatinib ameliorates autoimmune arthritis in animal models of RA [10-12] At micromolar ... clinical improvement in three refractory cases Ann Med 2003, 35:362-367 10 Koyama K, Hatsushika K, Ando T, Sakuma M, Wako M, Kato R, Haro H, Sugiyama H, Hamada Y, Ogawa H, Nakao A: Imatinib mesylate
Ngày tải lên: 12/08/2014, 11:23
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... the manuscript Both authors read and approved the final manuscript 16 Additional data files 17 The following additional data are available Additional data file 1 is a figure showing the ... 98:5306-5311 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx ... identified as described in Materials and methods. Microarray hybridization and data mining Differentiation protocol Total RNA isolation and polysomal RNA isolation Total RNA isolation and polysomal
Ngày tải lên: 14/08/2014, 08:20
Synchrotron based phase contrast X-ray imaging combined with FTIR spectroscopy reveals structural and biomolecular differences in spikelets play a significant role in resistance to Fusarium
... and NRC-Saskatoon, which are funded by the Canada Foundation for Innovation, the Natural Sciences and Engineering Research Council of Canada, the National Research Council Canada, the Canadian ... in a plastic bag at room temperature X-ray images of wheat spikes were recorded using the phase contrast imaging technique at the Biomedical and Imaging Therapy (BMIT) beamline at the Canadian ... graphical representation on the spread of the data [45] Geometrically, a PCA is a vector space transform It can be seen as a transformation applied to the coordinate axis rather than to the data
Ngày tải lên: 27/05/2020, 00:45
Aldehyde dehydrogenase activity plays a Key role in the aggressive phenotype of neuroblastoma
... such as ALDH 1A1 in melanoma and lung adenocarcinoma [20, 26], ALDH1B1 in colon cancer [27], ALDH 1A3 in breast cancer and NSCLC [28, 29], and ALDH 7A1 in prostate cancer [30] ALDH1 expression was also ... neuroblastoma Marjorie Flahaut1, Nicolas Jauquier2, Nadja Chevalier1,3, Katya Nardou1, Katia Balmas Bourloud1, Jean-Marc Joseph2, David Barras4, Christian Widmann3, Nicole Gross1, Raffaele Renella1 and Annick ... ALDH 1A3 gene were chosen in the published sgRNA library [41] Oligos were designed as follow: sgALDH 1A3 .1: forward 5’-CACCGCTACATGTAACCCTTCAACT-3’, reverse 5’-AAACAGTTGAAGGGTTACATGTAGC-3’, sgALDH 1A3 .2:
Ngày tải lên: 20/09/2020, 18:14
Prepositional phrase as functional words play an important role in the construction of phrases and sentences
... function as adjuncts to the clauses learning grammar is fun and you need to calm down Adjuncts are optional and can be removed without changing the meaning or grammaticality of the main clause Adverbials ... place and reason Adverbials are also optional and can be removed without changing the meaning or grammaticality of the main clause Particles Functioning as particles in phrasal verbs is the sixth ... played for the president The prepositional phrases in the mountains and for the president function as adverbials to the clauses The family hiked and The musicians played by describing place and
Ngày tải lên: 13/12/2021, 10:06
the development and evaluation of training curriculum play an important role in the educational development of vietnam
... should be associated with innovation in assessing the teaching process as well as innovating in testing and assessing students' learning achievements Evaluation of learning outcomes is the process ... determine what are the most effective ways to achieve the goal, while the evaluation adopts a criteria-based approach II.3.2 Backward design with a capacity development approach According to the backward ... implementation Curriculum design In language teaching, input, process, and output are the three main factors in the process and structure of a teaching design Input indicates language content - language
Ngày tải lên: 22/09/2022, 12:14
rho kinase myosin light chain kinase pathway plays a key role in the impairment of bile canaliculi dynamics induced by cholestatic drugs
... organization and cell motility6 The RhoA/Rho-kinase (ROCK) pathway plays a major role in vasocontraction and vascular tone regulation7 Activation of the RhoA/ROCK pathway is also essential for the ... functions in the liver22 Using these cholestatic agents and taking advantage of the well-polarized HepaRG and human hepatocytes, we investigated whether the ROCK/MLCK pathway has a critical role in ... major role in establishing bile ductular polarity in hepatic cells11, whereas other studies have demonstrated that BAs stimulate canalicular network formation and maintenance via the cAMP-liver kinase-B1
Ngày tải lên: 04/12/2022, 16:20
murine il 17 v 4 t lymphocytes accumulate in the lungs and play a protective role during severe sepsis
... Janeiro, Brazil The authors are greatful to Mariana Souza and Fernanda Schnoor for critical reading of the manuscript and to Thadeu Costa and Luana Correa for technical assistance Author details ... the manuscript; MFSC and CP wrote the manuscript All authors read and approved the final manuscript Authors information Claudia Farias Benjamim, Carmen Penido are considered last authors Page ... details Laboratório de Farmacologia Aplicada, Departamento de Farmacologia, Farmanguinhos, Fundaỗóo Oswaldo Cruz, Rua Sizenando Nabuco 100, Manguinhos, Rio de Janeiro, RJ, CEP 21041-250, Brazil 2Centro
Ngày tải lên: 02/11/2022, 14:34
Báo cáo hóa học: " Targeting the inflammation in HCV-associated hepatocellular carcinoma: a role in the prevention and treatment" pptx
... inducedHCC) in rats. Gallic acid treatment significantly attenuated some alterations (i.e. increased levels of aspartate transaminase, alanine transaminase, alkaline phosphatase, acid phosphatase, ... Open Access Targeting the inflammation in HCV-associated hepatocellular carcinoma: a role in the prevention and treatment Giuseppe Castello 1* , Susan Costantini 1* , Stefania Scala 2 Abstract ... 124(11):2520-7. 90. Jagan S, Ramakrishnan G, Anandakumar P, Kamaraj S, Devaki T: Antiproliferative potential of gallic acid against diethylnitrosamine- induced rat hepatocellular carcinoma. Mol Cell Biochem
Ngày tải lên: 18/06/2014, 16:20
Play and it’s role in the mental development of the child
... this area along the lines recommended by Marx when he said that ? ?the anatomy of man is the key to the anatomy of the ape.” They have begun their examination of early play in the light of later ... thing as play without rules and the child’s particular attitude toward them. Let us expand on this idea. Take any form of play with an imaginary situation. The imaginary situation already ... to the other sister in the whole play situation.) Only actions that fit these rules are acceptable in the play situation. In the game a situation is chosen that stresses the fact that these
Ngày tải lên: 23/06/2014, 09:52
báo cáo khoa học: " Determinants of the intention of elementary school nurses to adopt a redefined role in health promotion at school" docx
... f the instrument involves qualitative and quantitative approaches. The qualitative part consisted of obtaining information rele- vant to the study behaviour (i.e., adopting the new nur- sing role) ... guylaine.chabot.1@ulaval.ca 1 Research Group on Behaviour and Health, Faculty of Nursing, Laval University, Québec, Canada Full list of author information is available at the end of the article Chabot ... towards what the authors refer to as a ‘ strategic role? ?? , becoming a person of influence with partnership skills able to work with a broad range of actors and increasingly involved in the planning
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... AGGTGCTTT AAGAATAGTT TTT/AAAAACTATT CTTAAAGCAC CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- ... TTGCTGTAC/GTACAGCAAAAAC- TATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAA- TAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGG- TAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT ... CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- TAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG- TTTTTGCTGTACGTACAGCAAAAACTATT CTTA- AT GCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAA- GAATAGTTT
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT 1085 CTT1R ACGGTGGAAAAACGAACAAG PCR primers for W303 deletion strains ... photographed NAD+ measurements Table 5 Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R ... CTTCTTTTTGGGCCAATTCA 1280 BNA2 5' CTCGACGCTGATTGGCTAA 1248 YKL161CF TGGCCGAACTACTTGGTAGG 1281 BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC
Ngày tải lên: 14/08/2014, 21:20
Meiers germanys role in the euro crisis; berlins quest for a more perfect monetary union (2015)
... berpower can only be balanced by countervailing coalitions These unfounded U fears actually conceal the real challenges the Berlin Republic faces in putting the currency union on a lasting and stable ... http://ec.europa.eu/eurostat/ statistics-explained/index.php/Inflation _in_ the_ euro_area Evans-Pritchard, A (2014, June 9) ECB’s deflation paralysis drives Italy, France and Spain into debt traps The Telegraph http://www.telegraph.co.uk/finance/comment/ambroseevans_pritchard/ ... L’hyperpuissance americaine Paris: Fondation Jean Jaure`s 138 Germany’s Role in the Euro Crisis Management Wagstyl, S (2014, August 6) German diplomacy: Dominant by default Financial Times Wanner,
Ngày tải lên: 29/03/2018, 13:56
Emotion regulation and its relation to symptoms of anxiety and depression in children aged 8–12 years: Does parental gender play a differentiating role
... Council had no role in designing the study, collecting data, analysis or interpretation of data, or in writing the manuscript Availability of data and materials The datasets generated and/or analyzed ... literature, drafted and revised the manuscript, performed and interpreted statistical analyses AMS and TR was involved in drafting and revising the manuscript, and interpreting statistical analyses ... pattern as in the main analyses These findings may indicate that fathers more accurately see and report the dysregulation (LN) of emotion regulation behaviors of their depressed and anxious children
Ngày tải lên: 10/01/2020, 12:27
Extracorporeal shockwave therapy enhances expression of Pdia-3 which is a key factor of the 1α,25-dihydroxyvitamin D 3 rapid membrane signaling pathway in treatment of early osteoarthritis
... GCAAGGCCAAAATCACAGAT GTTCTTGCACAGCTTCACCA AAACAGCCCAGTGACCATTC GACAAGAAGCCCTTCACAGC Reverse 20-mer GGGGGATGTAGTTCTGCTCA Forward Reverse 20-mer 20-mer GAGGTGAAAAGGCTCAGTGC TGGGCCCATTGAAAAAGTAG Immunohistochemistry ... post-shockwave treatment in early OA rat knee model The other factors of the rapid membrane signaling pathway, including extracellular signal-regulated protein kinases (ERK1), osteopontin (OPG), alkaline ... degradation These findings indicated altered protein expressions in the pathogenesis of the early OA and illustrated a novel therapeutic avenue for the treatment of the early OA Among the proteins examined,
Ngày tải lên: 15/01/2020, 14:55
Bạn có muốn tìm thêm với từ khóa: