a potential role for modern biotechnology

... undertaken for each crop in each region) Food crops Alfalfa Banana and plantain Barley Beans Cabbage Cassava Maize Nuts Papaya Peppers Potato/sweet potato Rice Squash/zucchini Sugar-cane Tomato ... disease-resistant traits in rice, potato, maize, soybean, tomato, banana, papaya, sugarcane, alfalfa and plantain (Paarlberg 200 1a) Table lists some of the local crops in the priority research ... The potential to expand agricultural land exists in Latin America and sub-Saharan Africa only, where much of the remaining land is marginal for agricultural expansion The implication, therefore,...

Ngày tải lên: 13/03/2014, 21:48

... that vehicle categories vary in their attribute values/performances For example, although a consumer who drives an American car may not know the accurate attribute values of an Asian or European ... and Vanhonacker 1996) Chiang, Chib and Narasimhan (1999) demonstrate that the loyalty and brand constants would be overestimated, and the parameters of the marketing mix variables underestimated, ... information search and evaluation costs The individual factors that can explain consumer heterogeneity in search and evaluation costs include income, age, and education (Ratchford, Lee and Talukdar...

Ngày tải lên: 11/09/2015, 16:07

... (Kahneman, Knetsch and Thaler 1991) Choice alternatives are appraised relative to a status quo point, such that an option’s disadvantages are framed as losses and its advantages as gains (Kahneman ... Newsletters and information 3.1 Data Analysis and Results The resultant mean levels of participations of each experimental condition are reported in Table below Table 1: Mean participation levels as a ... the aggregate positive impacts of attractiveness of defaults, the opt-out approach can be anticipated to garner a larger proportion of participation, relative to the opt-in approach The latter approach...

Ngày tải lên: 12/09/2015, 08:16

... Health17 and the American Medical Association19 have recognized milk and other dairy foods as an important source of calcium for Americans The 1995 Dietary Guidelines for Americans states that “many ... E were associated with increased bone formation rate.107 A saturated fat diet increases the saturated/polyunsaturated fat ratio in bone and may spare vitamin E to enhance the formation of bone ... permission for reproducing figures and tables; Nancy Warner for help in preparing tables and graphs and for word processing assistance; and Marya Spangler for help with literature searches and collecting...

Ngày tải lên: 15/02/2014, 16:20

... experimental evidence on mental accounting, and motivates the analysis that follows 3.1 Data Panel Microdata Our main data source is a transaction-level file from a large U.S grocery retailer with gasoline ... separately by decade, the regular-grade share of total US gasoline sales as well as the (real) US average price for regular unleaded gasoline, from the EIA data Figure plots the regular-grade ... Marketing Annual: Explanatory Notes Energy Information Administration, Department of Energy Accessed at ...

Ngày tải lên: 06/03/2014, 21:20

... Canada MON-Ø4Ø32-6 (GTS 40- Monsanto 3-2) Canada, Japan, USA Australia (food), Canada, USA Australia (food), Canada, Japan, Korea, USA Australia (food), Canada, Japan, USA Australia (food), Canada, ... Korea, USA Canada, Japan, USA China, Mexico, Philippines Australia (food), Canada, EU, Japan, Korea, USA Australia, Canada, EU, Japan, Korea, USA China, Mexico, South Africa China, South Africa Aventis ... Nigeria, Netherlands, North Korea, Panama, Pakistan, Paraguay, Peru , Romania, Russia, Saudi Arabia, Slovenia, South Korea, Sri Lanka, Sudan, Swaziland, Syria, Tanzania, Thailand, Turkey, Uganda,...

Ngày tải lên: 26/03/2014, 14:08

... evidence that trastuzumab may synergize with specific T-cells [12], making a combinatorial approach with vaccination and trastuzumab an attractive clinical treatment modality pDNA immunization has several ... immunotherapy, such as plasmid DNA (pDNA) vaccination, is an alternative approach to antibody therapy and several properties make Her2 a promising tumor vaccine candidate [10,11] While trastuzumab seems ... by a relative A4 50 index of >2 or a titer

Ngày tải lên: 18/06/2014, 16:20

... per sample was made in an Anton Paar Multiwave 3000 microwave digestion system (Anton Paar, Graz-Straßgang, Austria), whereby the power was increased to 1,000 W after 15 and maintained for 30 ... cosmetics and pharmaceuticals such as local therapeutic agents, anti-diarrhoeal drugs or antacids Increased aluminium exposure can be compensated for by excretion via intestines and normal, healthy ... N, Kazi TG, Arain BM, Jamali MK, Afridi HI, Sarfraz RA: Application of factorial design in optimization of ultrasonic-assisted extraction of aluminum in juices and soft drinks Talanta 2006: 70(2):307–314...

Ngày tải lên: 20/06/2014, 21:20

... diners at a restaurant were studied The restaurant is located in a commercial and residential part of town and attracts patrons primarily in their late 20s to 40s The restaurant has a large bar counter ... basic necessities for human survival may be utilitarian in nature, utilitarian goods are not always necessities Typical purchases by most consumers in the United States, at least, are made after ... JE, at both the aggregate and individual levels In this experiment, the hedonic alternative when presented singly had a higher rating than a comparable utilitarian alternative on an absolute scale...

Ngày tải lên: 07/03/2014, 10:20

... four weak product arguments with regard to the digital camera’s capability to produce high quality images (named as image quality capability hereafter) Evaluation of image quality capability was ... participants’ attention Pretesting showed the time duration was adequate for participants to finish elaborating on all the information Thereafter, participants indicated the image quality capability ... interpreting the scene as a woman attending a wedding crying in joy) Results indicated that reappraisal reduced amygdala activation which is primarily associated with emotional reactions Although previous...

Ngày tải lên: 14/09/2015, 11:10

... primer target sequence The primers were designed using Primer Select software (DNA Star) Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) ... standard, cell lysates and plasma samples were separated using a Mini-PROTEAN® II The separation gel was a 14% polyacrylamide gel (National Diagnostics, Georgia) prepared following manufacturer’s directions ... (Santa Cruz Biotech, CA) followed by exposure to Hyperfilm (Amersham, UK) Statistical analysis The Shapiro Wilk test was applied to test for normally distributed data For non-parametric data,...

Ngày tải lên: 03/11/2012, 09:57

... two locations Candidates appraise locations differently Some people like urban life and the pacific coastal areas, and other people like rural areas and the mountains of the Appalachian region ... make the purchase of X the most attractive alternative 27 Chapter Consumer Choice and Demand in Traditional and Network Markets 28 usually charge an entry fee and then attach no marginal charge ... six pair-wise ways: A can call B or C, B can call A or C, and C can call A or B If there are four phone owners, then there are 12 potential pair-wise calls; five phone owners, 20 potential pair-wise...

Ngày tải lên: 17/12/2013, 15:18

... Highlands 259 Appendix 7*: Water quality data for the parishes of Camelford and Davidstow, 1989 259 Appendix 8*: Water quality data for the parishes of St Teath, Tintagel and Trevalga 259 Appendix ... the analysis of samples of water taken at a particular vicinity and time Sequential water quality data are not available to enable a description of the progress of the aluminium sulphate as it ... of water samples for water quality analyses 3.21 It is standard practice, when analysing for contaminants in water, that samples are taken into a prepared vessel in order to minimise contamination...

Ngày tải lên: 17/02/2014, 10:20

... Central District of California (C.D Cal.) District of Utah (D Utah) Middle District of Florida (M.D Fla.) Los Angeles, Riverside, Santa Ana, Woodland Hills Salt Lake City Orlando and Tampa The Bankruptcy ... discretion for deciding on reasonable expenses For instance, participants noted that judges can no longer rule against permitting someone with a large car loan to claim it as a reasonable offset against ... include the national and local standards, as well as a list of other necessary expenses, and are set out in the Internal Revenue Manual.1 The national standards set fixed dollar amounts, based on household...

Ngày tải lên: 18/02/2014, 02:20

... EJR Fitch JCR KBRA Moody’s Morningstar S&P Aaa AAA AAA AAA AAA AAA Aaa AAA AAA Aa AA AA AA AA AA Aa AA AA A A A A A A A A A Bbb BBB BBB BBB BBB BBB Baa BBB BBB Bb BB BB BB BB BB Ba BB BB B B B B ... creditworthiness If a rating scale has gradations within a category, the category and each gradation would constitute a “notch” in the rating scale For example, the symbols AA+, AA, and AA- would each represent ... “3” modifiers For example, AA+, AA, and AA- would be three gradations within the AA category with AA+ being the highest gradation and AA- being the lowest gradation in terms of relative creditworthiness...

Ngày tải lên: 06/03/2014, 08:20

Ngày tải lên: 07/03/2014, 02:20

... Standards Australia New Zealand, Product Standards Program, Canberra, Australia Franco Lajolo, Univ of Sao Paulo, Faculdade de Ciências Farmacêuticas, Sao Paulo, Brazil Nora Lee, Health Canada, Ottawa, ... useful for toxicological testing as are the common laborato- ANZFA 2001 Information for applicants: amending Standard A1 8/Standard 1.5.2ry animals such as rats, mice, rabbits, and guinea pigs ... other parts are eaten by animals (for example, forage) compositional analysis of both will need to be examined separately (for example, seeds vs seeds and forage vs forage) and may lead to different...

Ngày tải lên: 13/03/2014, 21:58

... marks, a tracker can record, for instance, that a bald, bearded man in a red sweater and blue jeans entered a department store on a A Science Is Born Saturday at 11:07 A. M., walked directly to a first-floor ... of a supermarket at 10:37 A. M A Science Is Born 15 on a Wednesday morning She has a handbasket, not a shopping cart, and has already selected store-brand vitamin C capsules and a large container ... shopping than has ever taken place anywhere at any time You almost have to make an effort to avoid shopping today Stay out of stores and museums and theme restaurants and you still are faceto-face with...

Ngày tải lên: 15/03/2014, 15:16

... have to forfeit an item (i.e., an upward prefactual) than when they acquire an item (i.e., a downward prefactual; see also Carmon and Ariely 2000) For example, someone who has so far enjoyed a ... one for an audio tape (or as partial payment for a compact disc ICD|) of the subjects' choice at a nearby local record store, the other for a lO-pack of brand-name computer disks at the nearby ... everyday consumer goods as primarily utilitarian (defined as useful, practical, functional, something that helps achieve a goal, e.g., a vacuum cleaner), as primarily hedonic (defined as pleasant and...

Ngày tải lên: 16/03/2014, 11:20

... such as a lack of clarity about default rankings and a lack of information about payments for ranking placements, rules for PCW practices could be developed These could initially take the form ... including a lack of adequate information on aspects like delivery costs, delivery time, taxes, and availability of products There is a lack of clarity and choice about default rankings; and importantly ... mystery shopping exercise has indicated that this is a common approach for specialised retailers with a panEuropean approach that use PCWs as a marketing tool for their national online shop fronts...

Ngày tải lên: 23/03/2014, 08:21