Isolation and characterization of the novel human gene, MOST 1

... impact on MOST- 1 function 11 9 MOST- 1 Protein 12 1 Aggregation and implication of MOST- 1 function 12 3 Interactors and their possible function with MOST- 1 126 MOST- 1 Expression and Cell Cycle 13 2 Current ... synchronization studies 94 v 4 .11 Yeast two hybrid screening 10 2 4 .12 Overexpression and RNA interference studies 11 0 CHAPTER 5: DISCUSSION Strategy and Isolation of MOST- 1 114 MOST- 1 Gene 11 5 Chromosomal localization ... Genomic structure analysis of MOST- 1 71 12 MOST- 1 expression profile 75 13 Chromosomal localization of MOST- 1 78 14 MOST- 1 ORF analysis using Plot Structure 87 15 Dot-blot of rabbit sera after immunization...

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... combinations of degenerate and speciﬁc primers and by rescreening the cDNA libraries The partial clones of XHIVEP2 and -3 covered 5.9 and 3.2 kb of the respective 3¢ ends and included 3¢-UTRs and poly(A)-tails ... analyze the function of XHIVEP in the context of Xenopus embryogenesis (data not shown) However, the interpretation of the in vivo role of XHIVEP was not conclusive as the activator and repressor ... constructs by the generation of deletion mutants containing discrete functional domains of XHIVEP1 Thus, the cloning and characterization of the XHIVEP interacting factors would be of interest and should...

Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

... very close to that of the mouse Muc4 (Table 1) The size of intron of the human MUC4 has been estimated to be 15 kb by restriction mapping [12] and to be at least 20 kb by our analysis of the human ... small mucin [26] The consensus sequence of the Muc4 tandem repeat is very close to that of SMC Nevertheless, the tandem repeat domain of Muc4 does not show signiﬁcant identity with the human MUC4 ... transcript of a predicted size of 13 kb Both human MUC4 and mouse Muc4 genes are virtually identical in terms of the class of introns, the exon number and size of exons The sizes of the 24 mouse...

Isolation, cloning and characterization of the FSH beta gene promoter of the chinook salmon (oncorhynchus tshawytscha)

... the mechanism of transcriptional regulation of the FSH subunit gene promoter of the Chinook salmon The Chinook salmon FSH subunit gene and 5’ flanking sequence will be isolated, sequenced and ... regard to the size of introns and 3’ untranslated region (3’ UTR; Figure 3) Compared to the 0.3 – 0.35 kb size of intron of the LHβ genes, the size of the corresponding intron in the FSH genes is ... extracellular proteins for the fish FSH subunit gene transcription, although the detailed mechanism remains to be elucidated 1.4 Hypothesis The promoter of the Chinook salmon FSH gene contains regulatory...

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

... aminoacids at the N-terminus of PHI (sequence: SKVYLALQDND) were compared with the sequences of the so called ‘intermediate components’ from two other PHs The N-terminal sequence of PHI from A radioresistens ... one PHR and one PHO (abc) protomer The hypothesis of a direct PHI phenol interaction is quite unlikely, because of the fact that the addition of phenol does not alter the emission spectrum of PHI ... oxygenase [28–30], and, in the case of Pseudomonas CF600 phenol hydroxylase, via a direct interaction with the substrate itself [9], in the case of A radioresistens S13 phenol hydroxylase, PHI...

Báo cáo Y học: Cloning and characterization of the mammalian-speciﬁc nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

... human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative analysis of the human, canine, and murine NICN1 cDNA revealed a ... CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG ... by the AMT gene for aminomethyltransferase, an enzyme of glycine metabolism [4 ,11 ] The promoters of the canine and murine NICN1 genes lack a TATA box-motif In both species, the sequences in the...

báo cáo khoa học: " Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)" ppt

... Figure analysis of methyl halides, methanethiol, and DMS from R sativus GC-MS GC-MS analysis of methyl halides, methanethiol, and DMS from R sativus (a) GC-MS spectrum of methyl halide standards ... the emission profiles of methyl halides from some plants and the characterization of the enzymatic properties of recombinant R sativus HTMT (RsHTMT) Results and discussion Wuosmaa and Hager [14] ... substrate for HTMT in A thaliana Cloning and sequence analysis of an HTMT coding gene from R sativus To investigate the properties of HTMT in R sativus, a full length HTMT-encoding gene (Rshtmt) was...

Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

... strain to those of the other simian rotavirus strains, SA11 and RRV Materials and methods Rotavirus isolation The YK-1 strain of simian rotavirus was isolated from the diarrheal stool of a 2-year-old ... was based on a Jennerianapproach prompted by studies indicating that animal and human rotaviruses share a common group antigen and that experimental animals immunized with human strains of rotavirus ... Virology Journal 2006, 3:40 C11 and Ala strains in rabbits [5], and human rotaviruses with piglets [6] Two simian rotavirus strains, SA11 and RRV, have been well characterized and are currently...

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 (a) CE (b) 12 0 Page 10 of 17 μ PM PMA2 86 NDR1 47 34 (c) (μg) 10 15 PM 26 soluble Figure The CaNDR1a protein is enriched in plasma ... enhanced disease resistance to the DC3000 strain, as previously reported Cacas et al BMC Plant Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 Page of 17 Figure The CaNDR1a protein...

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain speciﬁc for the human mitochondrial translocase receptor Tom70 potx

... degree of afﬁnity and speciﬁcity for Tom70, and with a KD of nM compares very well with afﬁnities reported for camelid VHH domains (that vary in the range 2–300 nM [36]) and for scFv and disulphide ... generate The human Tom70 receptor is an important example of such refractory targets, and the generation of a high-afﬁnity reagent speciﬁc for the cytosolic domain is a potentially valuable tool in the ... one variant, designated 15Z-2, showed changes mapping to either the CDR or Ó FEBS 2003 An IgNAR variable domain speciﬁc for human Tom70 (Eur J Biochem 270) 3551 Fig Eﬀect of removal of the 12F-11...

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... describes the relationship between the heme core description and the spectroscopic and redox properties of each identiﬁed heme from the NrfHA complex Conclusions D desulfuricans ATCC 27774 ccNiR ... this communication, we report for the ﬁrst time the isolation and biochemical characterization of D desulfuricans ATCC 27774 ccNiR subunits The stoichiometry between NrfH and NrfA is discussed The ... (2003) Cytochrome c nitrite reductase ˜ from Desulfovibrio desulfuricans ATCC 27774 The relevance of the two calcium sites in the structure of the catalytic subunit (NrfA) J Biol Chem 278, 17455–17465...

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... indicating that Rv1399c is composed of 22% of a- helices, 25% of b-strand and 39% of random coil The catalytic triad is located at the bottom of a small ˚ ˚ pocket, 20 A length and 10 A wide The pocket ... hydrolases (Fig 3) These enzymes share a functional catalytic triad made of a catalytic nucleophile serine, associated to a proton carrier histidine and a charge relaying aspartic (or glutamic) acid...

Báo cáo khoa học: Identiﬁcation and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2 doc

... box) Recognition of proteins containing CP2- binding motifs and veriﬁcation of the CP2- binding ability of REST and YY1 that contain the HXPR motif As stated above, none of the 12-mer peptide sequences ... 306–396) of the SPXX region on CP2 is involved in the binding of the ASR motif as well as HXPR (Fig 3) However, we not know whether these two motifs recognize the same sequences in CP2, and thus further ... characterized Of the proteins that have CP2- binding motifs, we further investigated the CP2 binding of the two HXPR-motif-containing proteins, REST and YYI Both REST and YY1 function as a transcription...

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the speciﬁc and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... (Fig 3A) These results indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU ... radiolabeled water was not observed with guaiacol It was clear that the b-aryl ether cleavage enzyme catalyzed the addition of two molecules of H2O (at Ca and Cb positions) and cleavage the b-aryl ... cleave the b-aryl ether linkages of GOUbz (III) and GOGbz (IV) In addition, the b-aryl ether cleavage enzyme failed to cleave the b-aryl ether linkage of GOU aO (Fig structure V) Thus, the b-aryl...

Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

... results, the expression vector pLac1-B was selected to characterize the recombinant laccase from A niger Immunodetection of the recombinant laccase and expression of the corresponding gene in A niger ... wild-type laccase from P cinnabarinus Immunodetection of the laccase was performed using antibodies raised against the P cinnabarinus laccase The Western blot analysis showed a unique band corresponding ... monokaryotic strain ss3 of P cinnabarinus In order to improve the secretion of the recombinant laccase, the laccase cDNA was fused to the GLA preprosequence and the production level markedly increased, up...

Xem thêm