isolation and characterization of acetyl coa carboxylase from c cryptica

Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot

Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot

Ngày tải lên : 12/08/2014, 11:22
... http://respiratory-research.com/content/11/1/94 stable acute PCD 10 stable acute PCD Figure Phenotype of MPs present in sputa of acute and stable CF and PCD patients In acute and stable CF patients, the number of ... patients in acute A B C CAL SS Log SS Log SS Log F E - IgM 78.5% CD66b FITC fluorescence (AU) CD66b 0.2% FITC fluorescence (AU) Event count CD66b Event count Event count S.a P.a MPs D CAL Discussion ... significantly higher levels of MPs expressing CD66b and CD11a in comparison to PCD patients (for CD66b: stable CF vs PCD: p = 0.0373; acute CF vs PCD: p = 0.0046 For CD11a: stable CF vs PCD: p...
  • 8
  • 292
  • 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Ngày tải lên : 18/02/2014, 16:20
... Journal compilation ª 2008 FEBS P V Castilho et al (5¢- CCG CTC GAG TTA AAA CAA ATG AAG-3¢), pulcintFW1 (5¢-CCT GTG CTT CGA GAT CCA AC-3¢), pulcintFW2 (5¢-GCA TCT ACC TAC CTT TTC AC-3¢), pulcintRW1 ... pulcintRW1 (5¢-CAC CCA TCG TTG GCT AGC CC-3¢) and pulcintRW2 (5¢-GTA AAG TGC CCA TTG CTG CTC-3¢) Each isoform whole sequence was submitted to a BLAST script databank search [33], which returned ... not successful and further characterization was abandoned A chromatofocusing step was included to separate the P III and P IV isoforms from the eluate P III ⁄ P IV (Fig 1C) Isoelectric focusing...
  • 12
  • 763
  • 0
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Ngày tải lên : 21/02/2014, 00:20
... hydroxylase and catechol 1,2 dioxygenase in Acinetobacter calcoaceticus NCIB 8250 Molec Microb 18, 13–20 Newman, L.M & Wackett, L.P (1995) Purification and characterization of toluene-2-monooxygenase from ... components’ from two other PHs The N-terminal sequence of PHI from A radioresistens S13 is identical (from residue number 3) to the sequence of the corresponding component of PH from A calcoaceticus NCIB ... addition of PHI (G Gilardi, Dept of Biological Sciences, Imperial College of Science, Technology and Medicine, London, UK, personal communication) On the other side, on the basis of X-ray scattering...
  • 7
  • 514
  • 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Ngày tải lên : 21/02/2014, 00:20
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... sequence previously acquired by chemical sequencing, the oligonucleotide ccNiR_GTPRNGPW, 5¢-GGIACICCIMGIAAYG GICCITGG-3¢, was synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT ... Structural and functional approach toward a classification of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR...
  • 12
  • 593
  • 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Ngày tải lên : 08/03/2014, 16:20
... following conditions: at 96 C; 39 cycles (94 C for min, 64 C for min, and 72 C for min) In addition to the above degenerated reverse primer two direct primers 5¢-AACCATGGCCTCCCACGCCGAGA AGCC(G /C) CTG-3¢ ... transcriptase (RT), and lM of the degenerated reverse primer 5¢-GCGGATCCTTA(G /C) ACGGCGGCGAAGTAC TCC-3¢ After reverse transcription for 30 at 42 C, the ®rst-strand cDNA was ampli®ed in a PCR performed ... 5¢-AACCATGGCCTCCCACGCCGAGA AGCC(G /C) CTG-3¢ and 5¢-AACCATGGCCAGCCAC 274 A Goyer et al (Eur J Biochem 269) GCCGAGAAGCC(G /C) CTG-3¢ were used PCR products were separated by electrophoresis on a 0.8% agarose...
  • 11
  • 608
  • 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Ngày tải lên : 16/03/2014, 18:20
... restriction site and primer 103 (5¢CTGCAGGAACATTTTCCCAACACC-3¢) extended by a PstI restriction site Primer 308 (5¢-GGATCCTCTGCAA CATCCGTA-3¢) extended by a BamHI restriction site and primer 103 ... primer 238 (5¢-CCATGGGA GGACGAAGCTTGACA-3¢) extended by an NcoI restriction site and primer 239 (5¢-AGATCTGAACATTTTCCC AACACC-3¢) extended by a BglII restriction site The PCR tubes contained 0.2 ... H2S, and NH3 [9,10] A similar activity was detected in several plant species, such as Spinacia oleracea, Chlorella fusca, Cucurbita pepo, Cucumis sativus and in suspension cultures of Nicotiana...
  • 14
  • 565
  • 0
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

Ngày tải lên : 17/03/2014, 10:20
... speci c activity and the availability of the species, we chose to clone and express the Conus carboxylase from C textile The full-length cDNA encoding the vitamin K-dependent carboxylase from C ... observed in COS cells transfected with a plasmid vector containing carboxylase cDNA arose from expression of carboxylase from this cDNA, we expressed recombinant Conus carboxylase in Sf21 insect cells ... shown) Speci c carboxylase activity of the recombinant Conus carboxylase The concentration of expressed Conus carboxylase in microsomes from transfected Sf21 cells and COS7 cells was determined by...
  • 11
  • 537
  • 0
Báo cáo khoa học: " Isolation and characterization of Streptococcus sp.from diseased flounder (Paralichthys olivaceus )in Jeju Island" ppt

Báo cáo khoa học: " Isolation and characterization of Streptococcus sp.from diseased flounder (Paralichthys olivaceus )in Jeju Island" ppt

Ngày tải lên : 07/08/2014, 18:21
... succocotcaL pb 0011 pb 003 eaini succocotpertS pb 817 sirebuarap succocotpertS negohtaP noiger tegraT GTTGGGCGCTCCCACG GLp CGCTAAGAGTAACAATAC GLp TCATATCGCTATATACTTCG 0782 apS GTTGTAACGGAGTCTGCTTT ... gnisuac seiceps laccocotperts wen owt :eliciffid succocotpertS dna iolihs succocotpertS H reivocreB ,Y onarejeB ,A radlE 11 83-33 ,91 ,6991 siD hsiF J sirebuarap succocotpertS htiw detaicossa ... esuac a ,eaeivrag succocotcaL YS uhC dna JY gneW ,CC iaL ,LJ eeL ,DY niL ,YS gnehC ,RG niL ,HT nehC ,CY nehC ,LK gnaY ,HY iasT ,CH gnahC ,YC uW ,CS oK ,YH uS ,LL waiL ,CS nehC 142-532 ,91 ,6991...
  • 6
  • 348
  • 0
Isolation and characterization of highly pathogenic avian influenza virus subtype H5N1 from donkeys docx

Isolation and characterization of highly pathogenic avian influenza virus subtype H5N1 from donkeys docx

Ngày tải lên : 10/08/2014, 05:21
... Muller CP, Müller S, Glisic S, Perovic V, Köhler H: Characterization of conserved properties of hemagglutinin of H5N1 and human influenza viruses: possible consequences for therapy and infection control ... amplicon was sequenced in both forward and reverse directions (Macrogen Inc., Korea) Viral RNA extraction and RT PCR Viral RNA was extracted from virus containing chorioallantoic membranes (CAM) ... al Journal of Biomedical Science 2010, 17:25 http://www.jbiomedsci.com/content/17/1/25 Page of Table 1: Serological screening of H5N1 exposure in donkeys from different localities of Beni-Suef...
  • 6
  • 265
  • 0
báo cáo khoa học: " Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)" ppt

báo cáo khoa học: " Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)" ppt

Ngày tải lên : 12/08/2014, 03:21
... terms of methyl acceptor preference: high specificity for I-, [SH]-, and [SCN]-, and low specificity for Cl- and Br- Purified RsHTMT showed a high specificity for [SCN]-, although much lower activity ... 2 C/ min increases to 50 C, and then 10 C/ min increases to 180 C Mass spectra were obtained at 70 eV using an electron-impact ion source (EI, 200 C) The retention times of CH3Cl, CH3Br, CH3I, CH3SH, ... and that of the GC-14A for CH3SCN was 0.05 mM (3.66 ppm) in the liquid phase The total amount of each product, except for CH3SCN and CH3CN, was calculated from the concentration of the gas phase,...
  • 10
  • 232
  • 0
Báo cáo khoa học: "Isolation and characterization of a genotype 4 Hepatitis E virus strain from an infant in China" ppt

Báo cáo khoa học: "Isolation and characterization of a genotype 4 Hepatitis E virus strain from an infant in China" ppt

Ngày tải lên : 12/08/2014, 04:21
... biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript ... showed no clinical symptom of hepatitis, which suggested that infants may be sub-clinically infected by HEV Conclusion In conclusion, our study showed that a genotype HEV strain infected a seven ... virus infection, rural southern People's Republic of China Emerg Infect Dis 2006, 12(11):1682-1688 Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central...
  • 4
  • 311
  • 0
Báo cáo khoa học: "Isolation and characterization of Treponema phagedenis-like spirochetes from digital dermatitis lesions in Swedish dairy cattle" pps

Báo cáo khoa học: "Isolation and characterization of Treponema phagedenis-like spirochetes from digital dermatitis lesions in Swedish dairy cattle" pps

Ngày tải lên : 12/08/2014, 18:22
... strong connection between wet/dirty claw environments and the occurrence of DD [4], for example in cubicle systems where accumulation of faeces and urine on the alleys is a typical hygienic problem ... antibiotics are often used These footbaths rapidly become contaminated with faeces and dirt and hence function as large selective cultures of antibiotic resistant bacteria In Sweden tetracyclines ... cultures to genotypic and phenotypic characterization Methods Bacterial isolates and growth conditions The spirochete isolates were obtained by culture from clinical submissions of tissue samples...
  • 8
  • 424
  • 0
Isolation and characterization of allergens from curvularia lunata 1

Isolation and characterization of allergens from curvularia lunata 1

Ngày tải lên : 14/09/2015, 08:47
... J04985 Candida boidinii Cand b Psilocybe cubensis Psi c Psi c cyclophilin 16 Cop c leucine zipper protein 11 Cop c thioredoxin Coprinus comatus AJ132235 AJ242791 Cop c AJ242792 Cop c AJ242793 Cop c ... Onyngeales…………………………… Trichophyton Class Saccharomycetes……………………… …….Saccharomyces, Candida Subphylum Basidiomycotina Class Holobasidiomycetes Order Agaricales………………………………Coprinus, Pleurotus, Psilocybe Order ... reported allergens which comprise molecules of various physiological and biochemical functions (Scheiner, 1995) Various allergens from pollens, house dust mites and cockroaches have been well studied,...
  • 24
  • 223
  • 0
Isolation and characterization of allergens from curvularia lunata 2

Isolation and characterization of allergens from curvularia lunata 2

Ngày tải lên : 14/09/2015, 09:09
... http://www.dbs.nus.edu.sg/research/ppc/index.htm MALDI-TOF-TOF mass spectrometric analysis of the generated tryptic peptides was carried out at The Proteins and Proteomics Centre (PPC), Department of Biological Sciences, ... for mass spectrometric analysis A total of bands were cut (Figure 2.6) Out of the bands cut, bands corresponded to the IgE binding bands from C lunata 1D western blots and bands 70 Chapter Figure ... ∆(mcrA) 183 ∆(mcrCB-hsdSMR-mrr)173 end A1 supE44 thi-1 recA1gyr 1A96 relA1 lac[F’proAB lacIqZ ∆M15Tn10(Tetr)] SOLRTM me14-(McrA-) ∆(mcrCB-hsdSMR-mrr)171 sbcC recB recJ uvrC umuC::Tn5(Kanr)lac gyrA96...
  • 54
  • 250
  • 0
Isolation and characterization of allergens from curvularia lunata 3

Isolation and characterization of allergens from curvularia lunata 3

Ngày tải lên : 14/09/2015, 09:10
... GACGACGACAAGATCATCACTGTCTACGACAACTCTGGCG - 3` R: 5`- GAGGAGAAGCCCGGTTTAGACGACGCTCCATGAGGCC - 3` F: 5`- GACGACGACAAGATCCCCACCGACTTTGATCCTAGCAA - 3` R: 5`- GAGGAGAAGCCCGGTTCAGCCTGCACGACACGGAA - ... GAGGAGAAGCCCGGTTTATAGCTGGCCGGAC - 3` F: 5`- GACGACGACAAGATGGATCTCTTCAAGAAGACACTCAAGCCC - 3` R: 5`- GAGGAGAAGCCCGGTCTACAACTCGTCGTGGTCCTGGG - 3` F: 5`- GACGACGACAAGATCCACGAGGCTGAGAACGCCGT - 3` R: 5`- GAGGAGAAGCCCGGTCTACAACTCGTCGTGGTCCTGGG ... GACGACGACAAGATGAGCAACATTCCCCAAGAG - 3` R: 5`- GAGGAGAAGCCCGGT TTACTTGGATGTGTCGAG - 3` F : 5`- GACGACGACAAGATCACTGTCAGCTACGACCCG - 3` R: 5`- GAGGAGAAGCCCGGT TTAAAGACCGCAGTTGCT - 3` F: 5`- GACGACGACAAGATCATCACTGTCTACGACAACTCTGGCG...
  • 33
  • 218
  • 0
Isolation and characterization of allergens from curvularia lunata 4

Isolation and characterization of allergens from curvularia lunata 4

Ngày tải lên : 14/09/2015, 09:15
... citrinum (ATCC16040), Alternaria alternata (ATCC6663) and Cladosporium herbarum (ATCC38810) were bought from American Type Culture Collection (ATCC) and cultured in the laboratory as per the ATCC (www.atcc.org) ... Figure 4.19: Self inhibition of ClCyp and cross-inhibition by AfCyp, ScCyp and HsCyp compared with the ClCyp self inhibition The pool of sera from the Cyp reactive Colombian population was used ... room carpet (LRC) and samples from kitchen floor (KF)] were screened 178 Chapter Curvularia alc (ClAlc) is a 352 amino acid long protein with predicted molecular weight of 37.5kDa and calculated...
  • 59
  • 203
  • 0
Isolation and characterization of allergens from curvularia lunata 5

Isolation and characterization of allergens from curvularia lunata 5

Ngày tải lên : 14/09/2015, 09:15
... Chapter 5.1 DISCUSSION AND CONCLUSION Not many allergenic fungi are studied well and very few of them have been characterized for the allergens in detail Characterization of the fungus and ... crossreactivity, structure and critical residues for allergenicity, levels in the environment, function, etc Here, we report various allergens from Curvularia lunata For the rapid isolation of ... in Curvularia lunata, 1D western blots of various fungi (including C. lunata) were developed The IgE binding bands present in C. lunata were excised and subjected to tandem mass spectrometric identification...
  • 9
  • 255
  • 0
Isolation and characterization of anticoagulant protein from the venom of hemachatus haemachatus (african ringhals cobra

Isolation and characterization of anticoagulant protein from the venom of hemachatus haemachatus (african ringhals cobra

Ngày tải lên : 14/09/2015, 13:36
... also acts in an anticoagulant capacity when combined with the cofactor thrombomodulin in the protein Case complex The product of the protein Case reaction, APC, inactivates the cofactors FVa and ... and activates protein C Endothelial protein C receptor (EPCR) stimulates the activation of protein C Activated protein C counteracts coagulation by cleaving and inhibiting the cofactors FVa and ... diagrams of the second and third kuniz domain of TFPI, Mechanism of action of TFPI, Ribbon diagram of the minimized mean structures of NAPc2, Mechanism of action of rNAPc2 The predicted anticoagulant...
  • 389
  • 220
  • 0
Isolation and characterization of stem cell regulatory genes oct4 and stat3 from the model fish medaka

Isolation and characterization of stem cell regulatory genes oct4 and stat3 from the model fish medaka

Ngày tải lên : 14/09/2015, 13:38
... ratio of 1.6-1.8, prior to storage at -80 C 2.2.1.2 Spectrophotometric determination of nucleic acids Spectrophotometric determination of nucleic acids bases on the fact that nucleic acids have ... Misccellaneous 65 2.2.7.1 Microscope and photograph 65 2.2.7.2 Promoter sequence analysis 65 iv Contents Chapter III Results 3.1 Cloning and characterization of medaka oct4 67 67 3.1.1 Cloning and ... Transcription factor Oct4 1.2.1 POU (Pit-Oct-Unc) family POU (Pit-Oct-Unc) family of transcription factors were originally named by four transcription factors Pit-1, Oct-1, Oct-2, and Unc-86, which...
  • 170
  • 340
  • 0
Isolation and characterization of cellulose nanofibrils from wheat straw

Isolation and characterization of cellulose nanofibrils from wheat straw

Ngày tải lên : 14/03/2016, 22:39
... either the acetyl and uronic ester groups of the hemicelluloses or the ester linkage of carboxylic group of the ferulic and p-coumeric acids of lignin and/ or hemicelluloses.17,26,28 It can be seen ... C O stretch band and deformation bands in cellulose, lignin and residual hemicelluloses.26 The increase of band at 897 cmÀ1 in chemically treated wheat straw fibers indicates the typical structure ... both structure and constitution In native cellulose the length of the crystallites can be 100–250 nm with average cross-sections of 3–10 nm Chemical and mechanical treatments affect the crystallite...
  • 10
  • 570
  • 0

Xem thêm