Functional analysis of TBX2A during development of the pharyngeal arches
Functional analysis of TBX2A during development of the pharyngeal arches
... of the pharyngeal arches 1.2.1 The contribution of the neural crest cells to pharyngeal development 1.2.2 Chondrogenesis – cartilage formation 1.2.3 The role of the endoderm pouches during pharyngeal ... support the hypothesis that the endodermal pouches play a leading role during the development of pharyngeal arches Analysis of expression pattern showed that tbx2a is also expressed in other endodermal ... development of the pharyngeal arches, the developmental roles of this gene in this part of the body remain unknown Although mature mammals including humans not possess functional pharyngeal arches...
- 150
- 322
- 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt
... activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter, ... for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with the C-terminal region of BMAL1 in ... 5) These results indicate that the bHLH region, including His57 and Arg65, is responsible for the E-box binding Determination of the region in BMAL1 for binding to DEC1 To identify the region in...
- 11
- 629
- 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx
... to the cytosol Here we confirm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal biogenesis is well established on the basis of the ... revealed the presence of Pex6p in the precipitate of full-length Pex1p ProtA and also the presence of Pex1p in the full-length Pex6p ProtA-precipitate (Fig 1C,D) These data confirm the in vivo interaction...
- 12
- 584
- 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon structures in Xenopus ... 2002 Functional analysis of Xenopus MGP gene promoter (Eur J Biochem 269) 1949 GGAAAC-3Â) for amplication of the region from )783 to +33, and (5Â-CCGGAGCTCGAGGGAGATGAGGAG GTGTGG-3Â) for amplication ... AGATCTACCACACCTCCTCATCTCC-3Â) for amplication of the region from )180 to )36 and (5Â-GAAGAT CTAACTAGATTTTACCATTGG-3Â) for amplication of the region from )180 to )72, respectively The )134/ )36TATALUC construct was PCR amplied...
- 10
- 475
- 0
Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot
... and catalytic properties of the mutants, and simulations of the substrate–enzyme interactions of the wild-type and one of the mutants The results provide indications of the native enzymes’ catalytic ... construction of the mutant b-glucosidases Findings that cytokinin-O-glucosides are natural substrates for both of the two b-glucosidases, Zm-p60.1 and Bgl4:1, but the architecture of their sites that ... sites involved in the two modes of aglycone binding The amino acid sequence of Zm-p60.1 was compared with the sequences of 22 other members of the GH1 family from 13 plant genera The resulting alignment...
- 13
- 400
- 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx
... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Section of the striate musculature (mu) and the ... emission upon binding characterize the binding sites of NPAs as highly nonpolar and completely isolated from the solvent Here we analyze the conformational and functional properties of Ag-NPA-1 as...
- 10
- 501
- 0
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx
... Thus, we present the nucleotide sequence, as well as a systematic structural and functional analysis of the 5¢ flanking region of the Bsep gene The 5¢ deletional analysis of the Bsep promoter revealed ... (Fig 6) Interestingly CDCA reduced the activity of the mutant m-126 Luc even below that of the wild-type p-126 Luc Analysis of the binding affinity of the putative FXRE site for the orphan nuclear ... protect hepatocytes against accumulation of toxic bile acids by preventing their further uptake and preserving or enhancing their excretion The discovery of bile acids as ligands of the orphan liver...
- 9
- 556
- 0
Báo cáo khoa học: Functional analysis of the methylmalonyl-CoA epimerase from Caenorhabditis elegans docx
... MCE on the human glyoxalase structure shows that the Co2+ ion ˚ of the MCE is only 0.2 A from the position of the Zn2+ ion in the glyoxalase [19] and it was suggested that the formation of a symmetric, ... a detailed study of the structure and expression of the mce-1 gene in C elegans Results and Discussion Identification and sequence analysis of C elegans MCE Searches in the C elegans databases ... on methylmalonyl-CoA This is of potential concern, as the activity of the epimerase in the crude cell extract could not be measured due to a methylmalonyl-CoA hydrolase 1469 Methylmalonyl-CoA epimerase...
- 13
- 560
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 1
... of processing body (P-body) that are known to participate in mRNA degradation and translational silencing, Decapping Protein 1a (DCP 1a) and Glycine-tryptophan protein of 18 2kDa (GW182), are also ... et al., 2005b), and that the C elegans homologue of GW182, Acyl-CoA carboxylase insensitive (AIN -1) , interacts with a putative AGO family protein, Asparagine-linked glycosylation (ALG -1) (Ding ... small RNA-mediated silencing Indeed, a preliminary study that examined the small RNA profiles of different developmental stages in D melanogaster has identified a unique class of small RNAs that...
- 49
- 221
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 2
... gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt ... caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgataccagcgcatc ... tttagctgtaagatgcttaaaggagct gaccaaataaaaataatacgacttc aactaattgctggcttgttatg tcattgacgataccagcgcatc tccgggtgcgtttaggtgag ttctatcaacaggctgtccacaggtt ccttcgtagtcgggtaggattattcgt aaaagacagacatgccttcgctccc...
- 25
- 252
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 3
... magenta, and cyan, respectively Although krimp was identified as a highly expressed mRNA in the GSCs from the microarray analysis, immunostaining of KRIMP indicates a wide expression in germline ... melanogaster germline cells (a) KRIMP localises to the perinuclear regions of the germline cells in the Drosophila ovary Ovaries were immunostained with anti-KRIMP (green) and anti-VAS (red) Bar ... (blue) Bar is µm An examination of the D/V marker GRK, indicated a loss of D/V polarity in krimp mutant oocytes The level of GRK expression was markedly reduced in 100% (n = 30 ) of the mutant ovarioles...
- 11
- 201
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 4
... vas, aub, cuff, and mael mutants In all of the examined mutants except mael, KRIMP perinuclear localisation was affected, while the localisation of AGO3 and MAEL appeared to depend on KRIMP, as ... It was also noticeable that VAS localisation depends partially on proper AUB localisation Although VAS foci were apparent in aub mutant, cytoplasmic VAS was visibly more abundant than in the ... Protein A/ G beads, in the presence of either HA-tagged AUB, CUFF, AGO3 or MAEL KRIMPMYC interacts directly with AUB-HA, CUFF-HA, and AGO3-HA The asterisk indicates the IgG band To confirm KRIMP association...
- 7
- 188
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 5
... the nuage site Indeed, a recent study has suggested that TUD aids in the association of piRNAs with AUB and AGO3 in an arginine methylationdependent manner (Nishida et al., 2009) The nuage components, ... silencing of LINEs/nonLTRs among the examined nuage components therefore implies a common role in maintaining the silenced state of the heterochromatic retroelements Vagin et al (2004 and 2006) have ... rescue the perinuclear localisation of AGO3 and MAEL, the expression level and anterior-dorsal localisation of GRK, and karyosome compaction of the oocyte; but not precocious osk mRNA translation in...
- 9
- 171
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 6
... that consist of nuage cytoplasmic foci docking partially around the mRNA degradation components Overlapping nuage/P-body foci are expressed as percentages of the total number of overlapping and ... non-overlapping P-body foci The range of overlaps (complete or partial) appears to be independent of the foci sizes and nuage/P-body pairs (b) Immunostaining of overlapping cytoplasmic AGO3 (red) and ... foci A complete overlap and partial overlap are indicated by a white arrow and arrowhead respectively Bar is μm (c) Immunostaining of non-overlapping Me31B A Me31B focus (green) that lacks the...
- 6
- 174
- 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 7
... that deadenylation is unaffected in at least one of the piRNA pathway mutant aub Figure 3.3 .7 Deadenylation is unaffected in aub mutant LM-PAT assay of cycB In the piRNA pathway mutant aub, deadenylation ... deadenylation appears unaffected since the poly (A) tail length is comparable to that of the control In contrast, deadenylation is impaired in the deadenylase mutant twin, as indicated by the accumulation ... exonuclease in the aub mutant (Figure 3.3.8), indicating that cycB mRNA is efficiently decapped Figure 3.3.8 Decapping is unaffected in aub mutant Cap analysis of cycB In aub mutant as well as in the...
- 7
- 167
- 0
Từ khóa: a functional analysis of the cameron site chipped stone assemblage01 1 3 22 developmental stages of the external form of the pharyngeal arches lateral viewsanalysis of the endocardial to mesenchymal transformation of heart valve development by collagen gel culture assaya biomechanical analysis of the respiratory pattern during the golf swing14 functional analysis of genetic variant a challenge for the futureectopic spindle assembly during maturation of xenopus oocytes evidence for functional polarization of the oocyte cortexissues which surfaced during ct reviews by recs that were included in the recs decision reportsidentification and analysis of the ethical scientific issues which surfaced during ct reviews by recs that were included in the recs decision reportsanalysis of the original text based on j house s model and halliday s systemic functional modelanalysis of the real sittuation of the training and development of human resource in evnhcmcanalysis of the real situation of the training and development of human resource in evnhcmcanalysis of the supremeanalysis of the germanfunctional anatomy of the heart pdffunctional anatomy of the cnsfunctional anatomy of the heart pptNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam