0

a biomechanical analysis of the respiratory pattern during the golf swing

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

Kinh tế - Quản lý

... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the ... is the constraint of L1 or the borrowing of a first language pattern or rule that leads to an error or inappropriate form in L2 As one of the goals of CA is the effective teaching and the learning...
  • 56
  • 2,601
  • 19
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Báo cáo khoa học

... Corporation; Hialeah, FL, USA) at the ÔServeis Cientifico-TecnicsÕ of the University of Barcelona, using the 488 nm line of an argon laser and standard optical emission filters Percentages of cells at ... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline as unique...
  • 7
  • 581
  • 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc

Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc

Cao đẳng - Đại học

... long-term analysis we assume the structure of the agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... hence, putting them at significant market disadvantage The bill sets a maximum amount of allowances that can be rebated to EITE industries at, 2% for 2012 and 2013, 15% in 2014, and then declining ... energy-related expenses, other farm expenses, and the value of agricultural production stays the same.10 To assess the impacts of HR 2454 beyond 2018, we assume the underlying structure of the agricultural...
  • 13
  • 651
  • 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học

... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... role as the catalytic base (c) D75E: aspartic and glutamic acids are dicarboxylic acids, but glutamic acid has an additional carbon in the lateral chain The clear effect of this change in the RNase...
  • 14
  • 477
  • 0
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf

Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf

Tiếp thị - Bán hàng

... large package In this case, note that two small packages are equivalent to a large package.14 With this assumption, the analysis with small packages is similar to the case when the firm only offers ... Note Small and large packages purchase small packages to reduce their total consumption and achieve a consumption pattern On the other hand, the introduction of small packages could also lead to ... requires that the per-unit margins from the small package are at least twice as large as the per-unit margins from the large package In this paper, we have assumed for simplicity that the marginal costs...
  • 16
  • 488
  • 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx

A Comparative Analysis of the Financing of HIV/AIDS Programmes docx

Ẩm thực

... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
  • 63
  • 312
  • 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx

Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx

Tổ chức sự kiện

... same channel allocations as existing legacy narrowband analog FM two-way radios To facilitate a gradual transition to the system, P25-compliant radios must be capable of demodulating legacy analog ... 20ms of audio, for a total 180ms of encoded audio in each LDU frame), plus additional metadata and a small amount of piggybacked low speed data Each LDU, including headers, metadata, voice subframes, ... and the standard implementations of it admit practical, exploitable vulnerabilities that routinely leak sensitive traffic and that allow an active attacker remarkable leverage At the root of many...
  • 16
  • 1,185
  • 0
Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx

Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx

Cao đẳng - Đại học

... are capital gains tax breaks (Arizona, Arkansas, Hawaii, Montana, New Mexico, North Dakota, South Carolina, and Vermont) and deductions for federal income taxes paid (Alabama, Iowa, Louisiana, ... State lawmakers have enacted a wide variety of tax changes over the past three years since the last publication of Who Pays Many of these changes have dramatically reshaped state and local tax ... California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted an “Amazon” law or reached an agreement with the online retailer...
  • 135
  • 1,516
  • 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

Ngân hàng - Tín dụng

... Freddie Mac and Fannie Mae, as well as advances made by the Federal Home Loan Banks) To further support the availability of mortgage financing, Treasury is initiating a temporary program to purchase ... Buildup and Meltdown of the Mortgage and Credit Markets The demand for residential real estate was seemingly insatiable After rising at an average annual rate of slightly less than percent during the ... of the appreciated value of the collateral property The share of the appreciated value is determined and due at the sale of the property or at the termination of the mortgage In addition to promoting...
  • 51
  • 467
  • 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học

... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis ... gene signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis ... on the acegene microarray database (DNA Chip Research Inc and Hitachi Software Co., Yokohama, Japan) The significance of GO term appearance in the up- and downregulated genes (compared with all...
  • 14
  • 597
  • 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes doc

A Comparative Analysis of the Financing of HIV_AIDS Programmes doc

Khoa học xã hội

... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
  • 63
  • 322
  • 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes potx

A Comparative Analysis of the Financing of HIV_AIDS Programmes potx

Sức khỏe giới tính

... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
  • 63
  • 328
  • 0
a comparative analysis of the cognitive moral development of independent public auditors in selected public accounting firms and bank examiners in selected federal banking regulatory agencies

a comparative analysis of the cognitive moral development of independent public auditors in selected public accounting firms and bank examiners in selected federal banking regulatory agencies

Kinh tế

... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without...
  • 143
  • 441
  • 0
báo cáo sinh học:

báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

Điện - Điện tử

... with their careers and the career opportunities available to them is a further measure of demoralization of nurses and offers some substantiation of the disaffection associated with working in the ... estimated by assessing the internal consistency of the scales by means of Cronbach's alpha The ultimate score that each nurse received for each factor was based on the simple summation of the ... that encourages adequate use of their abilities The availability of protective materials and functional equipment to safeguard nurses from unnecessary accidents, as well the implementation of...
  • 10
  • 514
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc

Hóa học - Dầu khí

... studies The analysis revealed several characteristic features with respect to the individual amino acids in the Vpr Of the 96 amino acids, all the amino acids except the initiator methionine have the ... development of vaccines based on the auxiliary genes of HIV-1 Authors' contributions AS, VA, AK, AB, VS, RC and AC participated in the analysis of the predicted amino acid sequences of Vpr SM, DD and ... targeting these enzymes The viruses containing alterations may then be able to evade the inhibitory activities of the agents and are designated as drug-resistant variants Similarly, the mutations...
  • 17
  • 434
  • 0
Báo cáo chuyên đề xây dựng

Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx

Báo cáo khoa học

... increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder  As the cylinder spacing increases, the wave force on the cylinders not decrease linear to the wave ... on an isolated cylinder, however it oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio   0.2  Due to the interaction of the ... in triangular array versus ratio   a / D for ka  1.0 Effect of Incident Wave Angle  incident wave Y X 2a D Wave force in x -direction acting on the cylinder at various incident wave angle...
  • 29
  • 422
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A quantitative analysis of the mechanism that controls body size in Manduca sexta" docx

Báo cáo khoa học

... larval instar grows from a mass of about 1.2 g to about 11 g, so almost 90% of the final mass of the larva is gained during this single instar Because most of the body mass of Manduca accumulates ... instar, the size increment from instar to instar is constant That is, the final mass of each is a constant multiple of the final mass of the previous instar As a consequence, the mass of a larva ... required is a measure or process that changes with the mass of the larva and for which the larva can measure the ratio between the current state and the state at the beginning of the instar Stretch...
  • 15
  • 356
  • 0
Báo cáo y học:

Báo cáo y học: "A meta-analysis of the incidence of malignancy in adult patients with rheumatoid arthritis" doc

Báo cáo khoa học

... exception, an SIR of 1.68, was in a Japanese population and the authors state that they observed a generally higher risk of malignancies in Japanese women with RA than that reported in comparable Caucasian ... interpretation of the data and helped to draft the manuscript SS performed the meta -analysis, participated in the evaluation of studies for inclusion, and helped to draft the manuscript All authors read and ... cases, there was considerable variation in the calculated SIRs among the individual studies for site-specific malignancies Nevertheless, the random effects meta -analysis demonstrated an overall pattern...
  • 8
  • 412
  • 0
Báo cáo y học:

Báo cáo y học: "A meta-analysis of the efficacy of fibromyalgia treatment according to level of care" pptx

Báo cáo khoa học

... and meta -analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... fibromyalgia when comparing primary care and specialised care Our meta -analysis demonstrates that there are no differences in the overall outcome of fibromyalgia regardless of the level of care ... participants The studies evaluated the treatment or management of fibromyalgia as indicated by the use of recognised diagnostic criteria, such as American College of Rheumatology (ACR) [1] Page...
  • 15
  • 530
  • 0
Báo cáo y học:

Báo cáo y học: " Foot and ankle surgery in Australia: a descriptive analysis of the Medicare Benefits Schedule database, 1997–2006" potx

Báo cáo khoa học

... HBM and MFG conceived the study HBM extracted, analysed and interpreted the data, and drafted the manuscript MFG and KBL assisted with data interpretation All authors read and approved the final ... clubfoot and tarsal coalition/congenital vertical talus procedures, and a steady decrease in the number of heel procedures (data not shown) Of particular note, there was a marked reduction in the ... surgical practice in response to: (i) research questioning the role of calcaneal spurs in the pathophysiology of heel pain [11]; or (ii) the recent availability of extracorporeal shock wave therapy...
  • 10
  • 369
  • 0

Xem thêm