Growth and property characterization of relaxor ferroelectric PZN PT single crystals
... Single Crystals Structural Characterization of PZN- PT Single Crystals 21 Domain Structures in Relaxor PZN- PT Single Crystals 28 Chapter 3: Growth and Longitudinal Properties of PZN- PT Single Crystals ... Properties of PZN- (6-7) %PT Single Domain Crystals 147 9.6 Full Property Matrices of Multi-domain PZN- 7 %PT Single Crystals1 49 9.7...
Ngày tải lên: 14/09/2015, 12:20
... Correlatively, activities of G6PDH (pentose phosphate pathway) and GDH (cellular detoxification of NH+) increased and ensured, respectively, the production of NADPH and NADH which are needed ... Discussion It will also be necessary to specify relationships nolic compounds, growth and between typical phe- their metabolism, rooting Ageing and rejuvenation of walnut tr...
Ngày tải lên: 09/08/2014, 02:21
... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and...
Ngày tải lên: 09/09/2015, 10:17
Preparation, characterization and property studies of carbon nanostructures derived from carbon rich materials
... Thesis Title: PREPARATION, CHARACTERIZATION AND PROPERTY STUDIES OF CARBON NANOSTRUCTURES DERIVED FROM CARBON RICH MATERIALS Abstract Carbon nanomaterials have always been an area of interest for ... amorphous carbon Physical and chemical properties of carbon vary in each of the allotropes For example, diamond is one of the hardest materials existin...
Ngày tải lên: 10/09/2015, 15:48
Tài liệu Growth and nutritional status of children with homozygous sickle cell disease ppt
... GR Prepubertal growth and skeletal maturation in children with sickle cell disease Pediatrics 1986; 78:124–32 33 Silva CM, Viana MB Growth deficits in children with sickle cell disease Arch Med ... 27% of 131 children with sickle cell anaemia (,18 yrs) had weights and heights ,22 SD compared with African multi-ethnic reference values.52 In Zambian chil...
Ngày tải lên: 12/02/2014, 19:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc
... above and in [1]) We investigated representative gene products from the E coli and Synechocystis sp bacteria further, to gain insight into the function of these proteins and the evolution of the MAPEG ... the six MAPEG families and three further groups (Insect, E.coliMGST cluster and SynMGST cluster) A major subgrouping is visible with MGST1, PGES and Insect in...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf
... products of the hazelnut LOX were compared with the reaction products of soybean LOX type I and authentic standards of 9- and 13-HODE As shown in Fig 4, 9-HODE is the main product of the hazelnut ... stages of seed development, and which is the only LOX detected in pea leaves [25] Considering the high level of expression of CaLOX2 in hazelnut seeds, it would be of...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf
... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclud...
Ngày tải lên: 22/02/2014, 07:20
Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf
... borrowing.2 A summary of the recent use of macroprudential measures in Latin America is reported in Table Despite their increasing use, the effectiveness of macroprudential policies in leaning against ... measure the changes in RRs and in other macroprudential policies Our findings indicate that RRs and other macroprudential policies lead to a moder...
Ngày tải lên: 06/03/2014, 04:21