Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation
Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation
... HUMAN EMBRYONIC STEM CELL- DERIVED NEURAL STEM CELLS: DERIVATION, DIFFERENTIATION AND MICRORNA REGULATION KWANG WEI XIN TIMOTHY (B.Sc (Hons), NUS) ... mechanisms of regulation of NSC differentiation 1.1.5.2 Pluripotent stem cell- derived NSCs Human embryonic stem cells (hESCs), which are pluripotent cells derived from the inner cell mass of blast...
báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx
... transplanted vascular cells derived from human ES cells and the vascular density in the infarct area after the transplantation In the saline- and hMNCs-injected groups, the vascular density of host ... characterization of transplanted cells derived from human ES cells We induced differentiation of human ES cells in an in vitro two-dimensional cu...
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
... culture feeding 3.2.3 Human embryonic stem cells and induced pluripotent stem cells Human embryonic stem cell line HES-3 (46, XX) was from ES Cell International (Singapore, http://www.escellinternational.com) ... forebrain, midbrain, hindbrain and the spinal cord This figure was reproduced from Epstein et al., 1999 2.4 SHH and neural development During the initial ph...
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"
... JM Embryonic stem cell lines derived from human blastocysts Science 1998;282(5391):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... Germany) with an HBO-103 mercury lamp and filter sets for FITC, Cy3.5, Texas Red, Cy5, Aqua, and DAPI Images were captured, processed, and analyzed using ISIS mBAND/mFISH imaging softwar...
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another me...
báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot
... functional hemangioblasts from human embryonic stem cells Nat Methods 2007, 4(6):501-9 Zambidis ET, Peault B, Park TS, Bunz F, Civin CI: Hematopoietic differentiation of human embryonic stem cells ... the expression of MHC proteins in human embryonic stem cells Proc Natl Acad Sci USA 2002, 99(15):9864-9 Li L, Baroja ML, Majumdar A, Chadwick K, Rouleau A, Gallacher L, e...
Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf
... adult stem cells is their inability to effectively grow in Human embryonic stem cells and therapeutic cloning culture Therefore, obtaining clinically significant amounts of adult stem cells may ... and characterization of human embryonic stem cells Stem Cells Dev 2004, 13, 325-336 18 Drukker M, Benvenisty N The immunogenicity of human embryonic stem- derived...
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration
... plating of hESC-derived chondrogenic cells Fig 17 Chondrogenic differentiation capability of hESC-derived chondrogenic cells Fig 18 Analysis of pluripotency and lineage- restriction of hESC-derived chondrogenic ... explored for their potential as viable cell sources for cartilage tissue engineering (Chung et al., 2008) Human embryonic stem cells (hES...
Establishment of autologous culture systems for human embryonic stem cells
... sources, named embryonic stem cells Literature review (ESCs), embryonic germ cells, fetal stem cells, umbilical cord stem cells, adult stem cells and induced pluripotent stem (iPS) cells (Ariff ... cell source for future clinical applications Literature review Table Characterization of stem cells by derivation source Category Embryonic stem cells Embryoni...
Baculovirus mediated genetic modification of human embryonic stem cells
... 1.1.1 Human Embryonic Stem Cells 1.1.2 Non-Viral Genetic Modification Systems for hES Cells 1.1.3 Viral Vectors for Genetic Modification of hES Cells 1.1.4 Baculovirus Vectors Mediated ... BACULOVIRUS- MEDIATED GENETIC MODIFICATION OF HUMAN EMBRYONIC STEM CELLS DU JUAN (B Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT...
The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders
... in the body There are four classes of pluripotent stem cells in humans, other primates and mice These are embryonic stem cells, embryonic germ cells, embryonic carcinoma cells and recently the ... stem cells versus embryonic stem cells The general differences between the characteristics of adult and embryonic stem cells are summarised in Table...
IN VIVO EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS
... staining (c) hFOB H & E staining (d) hFOB von Kossa staining Scaffold (e) hFOB H & E staining Figure At 2-week time point: H&E staining and von Kossa staining of sections showing scaffold and cells ... time point: H&E staining and von Kossa staining of sections showing scaffolds devoid of cells 43 Figure At week time-point: (a) H&E staining showing newly formed tissue within the ......
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...