Shell transformation model for simulating cell surface structure

... three main types: shell, shell with a liquid core, and solid model Shell Model The shell model adopts a thin shell theory to describe the deformation of the surface structure This model was applied ... the cell surface structures when the cell carries out the biological processes The changes are represented by transformation strains, forces, and dipoles in the shell The model is termed the shell ... springs Shell with Liquid Core model Modeling cells as a shell with a liquid core includes the eﬀects of the thin surface structure and the cytoplasm on the deformation of the cells In this model, ...

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC ... TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG...

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding afﬁnity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine whether the nucleolin identiﬁed ... This revealed a band at approximately 95 kDa present in the PTPr eluate only These data conﬁrm that nucleolin is a binding partner for PTPr under these conditions PTPr can bind directly to nucleolin...

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

... effect of HFE binding to TfR1 is to lower the afﬁnity of the receptor for transferrin [15] This most likely reﬂects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin receptor [15] The crystal structure of HFE complexed to the ... We propose that glycosylation is important for the folding of HFE and is essential for transport and exit of the protein from the ER The importance of glycosylation is cumulative, however, with...

Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx

... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin -staphylokinase complex by alpha2-antiplasmin J Biol ... 26 Navaza, J (1994) AMORE: an automated package for molecular replacement Acta Crystallogr A5 0, 157±163 27 Brunger, A (1993) X-PLOR, Version 3.1 A System for X-Ray Crystallography and NMR Yale ... designated as a a, head±tail, and b±b The a a dimer has a diad and is characterized as helix-helix packing between the two monomers, as shown in Fig 2A The head±tail dimer is formed by a crystallographic...

Báo cáo khoa học: "Structural Topic Model for Latent Topical Structure Analysis" pot

... In this paper, we propose a new topic model, named Structural Topic Model (strTM) to model and analyze both latent topics and topical structures in text documents To so, strTM assumes: ... compared with the baseline methods that don’t explicitly model the topical structure The results conﬁrm the necessity of modeling the latent topical structures inside documents, and also demonstrate ... structure “suggested” to move 1534 In this paper, we proposed a new structural topic model (strTM) to identify the latent topical structure in documents Different from the traditional topic models,...

Báo cáo hóa học: " Research Article A Robust Structural PGN Model for Control of Cell-Cycle Progression Stabilized by Negative Feedbacks" pdf

... noise and parameters’ random variation The natural follow up of this research is to infer the PGN model from available dynamical data of cell-cycle progression, analogously to what we have done for ... regulatory system of the malaria parasite [5, 6] We anticipate that, very likely, analysis of these dynamical data will uncover unknown negative feedback loops in cell-cycle control mechanisms ACKNOWLEDGMENTS ... weight for variable x j at time t − in the driving function of variable xi If variable x j is an activator of variable xi , then a ji = 1; if variable x j is an inhibitor of variable x j , then a...

Báo cáo hóa học: "A Probabilistic Model for Face Transformation with Application to Person Identiﬁcation" pot

... using a face transformation model In the case where we have multiple template images for person P, we should combine them into a single face model ᏹ p (this would require a new formula for the face ... significantly outperform two popular face recognition algorithms, namely eigenfaces and ﬁsherfaces Finally, we outline future work MODELING FACE TRANSFORMATION In this section, we model the transformation ... automatically all the parameters of the face transformation model ᏹ, that is, {w}, {δ }, {Σ}, and transition probabilities {aᏴ } and {aᐂ } A Probabilistic Model for Face Transformation 513 Table 1: HMM notation...

Báo cáo khoa học: "Developing an Agrobacterium-mediated transformation system for Lilium x formolongo using thin cell layer of bulb scales" ppsx

... expression, implying a successful transformation of Lilium x formolongo by Agrobacterium using thin cell layers of bulb scales Fig Results of transformation via Agrobacterium using thin cell layers ... Nguyen Thi Thuy, Nguyen Quang Thach experiments, we investigated the potential of using thin cell layers of bulb scales for production of trangenic bulblets in Lilium x formolongo, a new lily variety ... used for selecting putative transformants of Lilium x formolongo in the subsequent transformation experiments 125 Nguyen Thi Phuong Thao, Nguyen Thi Thuy, Nguyen Quang Thach Table Effect of the...

Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx

... by trypsin treatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75% confluence Flow cytometry analysis of cells Either isolated cells from OC were directly used for flow cytometric analysis or cells ... functionality of cell surface molecules on human mesenchymal stem cells J Biomed Sci 2003, 10:228-241 Reyes M, Verfaillie CM: Characterization of multipotent adult progenitor cells, a subpopulation of mesenchymal ... analysis of fresh isolated chondrocytes from osteoarthritic cartilage (a) Forward/side scatter (b) Markers were cartilage set in the channel display with a maximum of 2% positive cells by staining...

báo cáo khoa học: " Surface structure, model and mechanism of an insect integument adapted to be damaged easily" pot

... cuticle surface of other arthropods than sawflies, such as in nymphs of bugs and ticks [13] and in adults of flies and dragonflies [14,15] Their function is to allow by stretching an increase of body ... for defense Insect Defenses: adaptive mechanisms and strategies of prey and predators Edited by: Evans DL, Schmidt JO Albany: State Univ of New York Press; 1990:23-61 St Leger RJ: Integument as ... for the model on LM views, and wrote the manuscript, except the parts about this model in Results and Methods VD obtained most SEM views TM and PB performed the model by finite elements and wrote...

Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

... suspension for h at 4°C and virus attachment was subsequently measured using RT-PCR B) MOI TCID50 /cell of CVB2O was incubated as described in A) at 4°C or at room temperature and attached virus was measured ... demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and HeLa remained at the same level Thus, a significant ... amount of bound radioactivity is used as a measurement of the viral attachment capacity In this article, we demonstrate that RT-PCR is an alternative, rapid and efficient method to study viral...

Báo cáo y học: " Six host range variants of the xenotropic/polytropic gammaretroviruses define determinants for entry in the XPR1 cell surface receptor" ppt

... infectivity on mouse cells carrying the variants of Xpr1 (Table 2) Both viruses infected NIH 3T3 (Xpr1n) and cells carrying Xpr1sxv, but did not infect cells of M pahari (Xpr1p) or cells carrying Xpr1c ... carrying Xpr1sxv with high efficiency, shows very poor infectivity on cells carrying Xpr1c and on Rat2 cells, and is restricted by hamster cells and cells carrying the mouse Xpr1n and Xpr1p variants ... host range variant defined by AKR6 and XMRV Three of the four XPR1 variants of Mus supported replication of XMVs; only Xpr1n of the laboratory mouse strains failed to mediate infection of any...

Báo cáo sinh học: "Data transformation for rank reduction in multi-trait MACE model for international bull comparison" doc

... Table V Ranking correlations for Holstein bulls of the multiple lactation MACE (ML -MACE) and the reduced rank random regression MACE models with the random regression MACE model Rank reductions ... deviations, Interbull Bull 32 (2004) 46–52 Rank reduction in MT -MACE models 307 [10] Madsen P., Jensen J., Mark T., Reduced rank estimation of (co)variance components for international evaluation using ... evaluation models for both national and international evaluations, Sullivan and Wilton [18] and Liu et al [9] proposed a multiple trait MACE (MT -MACE) model for international bull comparison This model...

Development of human stem cell based model for developmental toxicity testing

... toxicity 15 2.2.2 In vivo animal studies for developmental toxicity testing 17 2.3 In vitro animal -based models for developmental toxicity testing 18 2.3.1 The MM assay 19 2.3.2 ... However, current animal -based models for developmental toxicity testing is limited by time, cost and high inter-species variability, while human pluripotent stem cell (hPSC) models are only focusing ... the developmental toxicity of various xenobiotics, including both in vivo and in vitro platforms Animal -based in vivo tests used to be the only generally accepted methods for developmental toxicity...

Xem thêm

Từ khóa: a model for stem cell therapy in regenerative medicine a land transformation model for the saginaw bay watershed a structured model for joint learning a model for the micro structured reactor plant concept assessment of a parametric hurricane surface wind model for tropical cyclones in the gulf of mex model systems for studying cell wall lignification computational model for trabecular bone structure quot atom like quot shell model for quantum dots cellisa reporter cell based immunization and screening of hybridomas specific for cell surface antigens use of colloidal silica beads for the isolation of cell surface proteins for ms use of colloidal silica beads for the isolation of cell surface proteins for mass spectrometry based proteomics cell surface capturing technologies for the surfaceome discovery of hepatocytes a model for cochlear stem cell biology in humans nobilis a model for understanding molluscan shell formation development and evaluation of qsars for ecotoxic endpoints the benzene response surface model for toxicity Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ