Shell transformation model for simulating cell surface structure

... three main types: shell, shell with a liquid core, and solid model Shell Model The shell model adopts a thin shell theory to describe the deformation of the surface structure This model was applied ... the cell surface structures when the cell carries out the biological processes The changes are represented by transformation strains, forces, and dipoles in the sh...

Ngày tải lên: 10/09/2015, 08:36

... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGT...

Ngày tải lên: 18/02/2014, 06:20

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...

Ngày tải lên: 19/02/2014, 05:20

... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin recepto...

Ngày tải lên: 06/03/2014, 22:21

... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin -staphylokinase complex by alpha2-antiplasmin J Biol ... 26 Navaza, J (1994) AMORE: an automated package for molecular replacement Acta Crystallogr A5 0, 157±163 27 Brunger, A (1993) X-PLOR, Version 3.1 A System for X-Ray Crystallogr...

Ngày tải lên: 23/03/2014, 21:21

... In this paper, we propose a new topic model, named Structural Topic Model (strTM) to model and analyze both latent topics and topical structures in text documents To so, strTM assumes: ... compared with the baseline methods that don’t explicitly model the topical structure The results confirm the necessity of modeling the latent topical structures inside documents, and a...

Ngày tải lên: 30/03/2014, 21:20

... noise and parameters’ random variation The natural follow up of this research is to infer the PGN model from available dynamical data of cell-cycle progression, analogously to what we have done for ... regulatory system of the malaria parasite [5, 6] We anticipate that, very likely, analysis of these dynamical data will uncover unknown negative feedback loops in cell-cyc...

Ngày tải lên: 22/06/2014, 19:20

... using a face transformation model In the case where we have multiple template images for person P, we should combine them into a single face model ᏹ p (this would require a new formula for the face ... significantly outperform two popular face recognition algorithms, namely eigenfaces and fisherfaces Finally, we outline future work MODELING FACE TRANSFORMATION In this s...

Ngày tải lên: 23/06/2014, 01:20

... expression, implying a successful transformation of Lilium x formolongo by Agrobacterium using thin cell layers of bulb scales Fig Results of transformation via Agrobacterium using thin cell layers ... Nguyen Thi Thuy, Nguyen Quang Thach experiments, we investigated the potential of using thin cell layers of bulb scales for production of trangenic...

Ngày tải lên: 06/08/2014, 19:20

... by trypsin treatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75% confluence Flow cytometry analysis of cells Either isolated cells from OC were directly used for flow cytometric analysis or cells ... functionality of cell surface molecules on human mesenchymal stem cells J Biomed Sci 2003, 10:228-241 Reyes M, Verfaillie CM: Characterization of multipotent adult pro...

Ngày tải lên: 09/08/2014, 01:23

... cuticle surface of other arthropods than sawflies, such as in nymphs of bugs and ticks [13] and in adults of flies and dragonflies [14,15] Their function is to allow by stretching an increase of body ... for defense Insect Defenses: adaptive mechanisms and strategies of prey and predators Edited by: Evans DL, Schmidt JO Albany: State Univ of New York Press; 1990:...

Ngày tải lên: 11/08/2014, 00:22

... suspension for h at 4°C and virus attachment was subsequently measured using RT-PCR B) MOI TCID50 /cell of CVB2O was incubated as described in A) at 4°C or at room temperature and attached virus was measured ... demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and...

Ngày tải lên: 12/08/2014, 04:21

... infectivity on mouse cells carrying the variants of Xpr1 (Table 2) Both viruses infected NIH 3T3 (Xpr1n) and cells carrying Xpr1sxv, but did not infect cells of M pahari (Xpr1p) or cells carrying Xpr1c ... carrying Xpr1sxv with high efficiency, shows very poor infectivity on cells carrying Xpr1c and on Rat2 cells, and is restricted by hamster cells and cells carrying the mouse Xpr...

Ngày tải lên: 12/08/2014, 23:22

... Table V Ranking correlations for Holstein bulls of the multiple lactation MACE (ML -MACE) and the reduced rank random regression MACE models with the random regression MACE model Rank reductions ... deviations, Interbull Bull 32 (2004) 46–52 Rank reduction in MT -MACE models 307 [10] Madsen P., Jensen J., Mark T., Reduced rank estimation of (co)variance components fo...

Ngày tải lên: 14/08/2014, 13:22

... toxicity 15 2.2.2 In vivo animal studies for developmental toxicity testing 17 2.3 In vitro animal -based models for developmental toxicity testing 18 2.3.1 The MM assay 19 2.3.2 ... However, current animal -based models for developmental toxicity testing is limited by time, cost and high inter-species variability, while human pluripotent stem cell (hPSC) mod...

Ngày tải lên: 09/09/2015, 08:18