... (µm) wall widths (µm) Image analysis Cell wall prop Rect Packing density (kg/m3) Rect H (µm) Cell wall prop Hexag Packing density (kg/m3) Hexag Cell wall prop Packing density (kg/m3) Cell wall ... density of the cell wall = drx / cell wall proportion = drx · S/s = drx · H2 / (H2 – H’2) The use of rectangular and hexagonal models of cell shape allows the determination of the mean cell wall area, ... analysis Tang φ (µm) Cell wall prop Rect Packing density (kg/m3) Rect H (µm) Cell wall prop Hexag Packing density (kg/m3) Hexag Cell wall prop Packing density (kg/m3) Cell wall prop (Masked) Packing...
Ngày tải lên: 08/08/2014, 01:22
... Additional File two cells synchronized oscillation of the two cells Click here for file [http://www.biomedcentral.com/content/supplementary/14773155-2-9-S1.mpg] Additional File two sets of cells synchronized ... of cells Click here for file [http://www.biomedcentral.com/content/supplementary/14773155-2-9-S2.mpg] References Harary I, Farley B: In vitro studies on single beating rat heart cells II Intercellular ... present in the suspension were separated from other cells (i.e., fibroblasts and endothelial cells) by the density centrifugation method The cell suspension was then layered onto 40.5% Percoll...
Ngày tải lên: 11/08/2014, 00:22
Tài liệu An Introduction to Intelligent and Autonomous Control-Chapter 2: A Reference Model Architecture for Intelligent Systems Design pdf
Ngày tải lên: 26/01/2014, 07:20
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx
... simple cellular models [25] Indeed, when Cell- free translation for protein engineering functional protein synthesis occurs inside liposomes, it provides a platform for simulating a complex cellular ... closely resemble the cellular envelope Based on the concept that translation is one of the central cellular processes required for life, cell- free transcription ⁄ translation systems have been widely ... relating to cell- free translation systems for enhancing the synthesis of biologically active proteins, the creation of cell- like compartments and the synthesis of artificial proteins Overview Cell- free...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: The influence of cold shock proteins on transcription and translation studied in cell-free model systems pdf
... with mRNA Therefore free mRNA accumulates in these cell- free systems [13] and excessive secondary structure formation takes place Results Effect of cold shock proteins on the combined cell- free transcription/translation ... temperature shift to 42 C carried out for h Cells were centrifuged and lysed as described [31] After cell lysis and centrifugation the cell- free extract was heated to 65 C for 40 to precipitate most of ... supported by the Deutsche Forschungsgemeinschaft We thank Christian Herrmann for helpful discussions and Franz Schmid for providing the clones for BcCSP and BsCSP We thank S Yokojama for helping us initially...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo y học: "Gene expression profiles in the rat streptococcal cell wall-induced arthritis model identified using microarray analysis" docx
... reactivation experimental design for the time Schematic representation of themodel of streptococcal cell wall course study in the reactivation model of streptococcal cell wall (SCW)-induced arthritis ... Biosystems) and optimized for use The forward primers, reverse primers and probes used are summarized in Table The final optimized concentrations of forward primer, reverse primer and probe for ... autoimmune phenomena An animal model that shares some of the hallmarks of human RA is the reactivation model of streptococcal cell wall (SCW)-induced arthritis in rats In this model, a synovitis with...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
... infrastructure for further facili at t ing such research In addition to the importance of the python as a model for research, different snake species have been used as model systems for different ... transcriptomic data collected, and an effort to make available sets of sequences for use as molecular markers for snakes (for example, microsatellite primers and orthologous loci for use in phylogenetics and ... certain that efforts to build resources for particular species are not duplicated, and that scientific arguments for the need for genomic resources of parti u c lar types, or for particular...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... AIDS models for pre-clinical testing of novel INSTIs for HIV1 and HIV-2, and 2) is a basis for a new and effective ART regimen for the simian AIDS model entirely based on drugs adopted for treatment ... (Applied Biosystems), then held at 95°C for 10 min., and run for 40 cycles at 95°C for 15 sec and 60°C for The following PCR primer/probes were used: SIV2-U 5’ AGTATGGGCAGCAAATGAAT 3’ (forward primer), ... synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence Retrovirology 2009, 6:52 Denton PW, García JV: Novel humanized murine models for HIV research Curr HIV/AIDS Rep 2009,...
Ngày tải lên: 12/08/2014, 23:23
Shell transformation model for simulating cell surface structure
... suitable for simulating static systems A suitable model for dynamic systems that involve oscillatory forces is the power-law structural damping model (Fabry et al 2001) The model includes the effects ... with Liquid Core model Modeling cells as a shell with a liquid core includes the effects of the thin surface structure and the cytoplasm on the deformation of the cells In this model, the surface ... This model was successfully applied to simulate the aspiration process during which cells are drawn into a pipette The Newtonian liquid core model is valid for red blood cells; however, the model...
Ngày tải lên: 10/09/2015, 08:36
Random beamforming for multi cell multiple input multi output (MIMO) systems
... specifications for the networks It is necessary to note that in those cases, the rate region should follow the specifications Certainly, the rate RBF FOR MULTI -CELL MIMO SYSTEMS Cell H D NGUYEN Cell Cell ... considerably different for multi-user systems, where the inter-user/inter -cell interference exists and severely 10 RBF FOR MULTI -CELL MIMO SYSTEMS H D NGUYEN affects the performance In Chapter 2, ... constraint for the single -cell MIMO-BC case In contrast, if transmit messages are RBF FOR MULTI -CELL MIMO SYSTEMS H D NGUYEN only locally known at each BS, coordinated precoding/beamforming can...
Ngày tải lên: 10/09/2015, 09:27
Diffusion of photovoltaic systems for rural electrification in Thailand
... suitable for this paper is the distinguishing between formal and informal institutions The examples of formal institutions are written laws and governmental regulations while examples of informal ... This makes Thailand a good location for utilizing PV systems The affordability challenge is more complex Historically prices for producing electricity with PV systems have not been competitive ... components The relevant type of linkage for this paper is interaction linkage between different actors [17] We separate it to formal and informal linkages By saying formal, we mean that it is an established...
Ngày tải lên: 05/09/2013, 16:10
Designing Systems for Application Concurrency
... enforcing the lock at write time, for all writers, can be done using a trigger: CREATE TRIGGER tg_EnforceCustomerLocks ON Customers 249 CHAPTER DESIGNING SYSTEMS FOR APPLICATION CONCURRENCY FOR ... amount of profile form duplication as well as the fact that many of the forms are filed in the wrong order It would be a huge waste of time for the data input operators if, for instance, one ... DESIGNING SYSTEMS FOR APPLICATION CONCURRENCY Unfortunately, this approach is fraught with issues The first and most serious problem is that between the query in the IF condition that tests for the...
Ngày tải lên: 05/10/2013, 08:48
Beverages as Delivery Systems for Nutraceuticals
... nutraceuticals for cancer prevention, similar research is routinely accomplished in the search for new cancer drugs and drugs for other diseases Cell kinetics is the repetitive cycle (time) for cell reproduction ... Table 3.4 This information is similar to the information presented for a food ingredient/nutraceutical petition for FDA self-afÞrmed Generally Recognized as Safe (GRAS) status or for a health claim ... common tag line for these products is “Stimulation for Body and Mind.” The term stimulator beverage was chosen for this review rather than the more common terms of energy drink or performance enhancer...
Ngày tải lên: 25/10/2013, 21:20
A general framework for studying class consciousness and class formation
... ``weak'' class formations; unitary or fragmented class formations; revolutionary, counterrevolutionary or reformist class formations Typically, class formations involve creating formal organizations ... selection and transformation In elaborating a micro -model of class consciousness and a macro -model of class formation we will describe the causal relations among the various elements of the models in ... problem of the causal models of class consciousness and class formation A general framework 199 Figure 10.4 Forms of determination: limits, selects, transforms 10.3 The micro -model If class consciousness...
Ngày tải lên: 01/11/2013, 07:20
Training systems for telecommunications
... responsible for typographical errors TELECOMMUNICATIONS Technical Training Systems Known for Excellence in Technical Training Introducing Lab-Volt’s Award-Winning Training Systems for Analog & Digital ... Building Training Systems for the Global Workplace For over four decades, Lab-Volt has provided state-ofthe-art systems for technician training in the basic and most ... in modern communications systems The Reconfigurable Training Module, Model 9431-1, used in the 8087 System is the same platform used for many other Lab-Volt Training Systems, such as the 8086...
Ngày tải lên: 06/11/2013, 11:15
A practical guide for studying chua's circuits
... on Cellular Self-Organizing Nets and Chaotic Nonlinear Dynamics to Model and Control Complex Systems R Caponetto, L Fortuna & M Frasca Volume 64: Control of Chaos in Nonlinear Circuits and Systems ... 69: Modeling by Nonlinear Differential Equations P E Phillipson & P Schuster Volume 70: Bifurcations in Piecewise-Smooth Continuous Systems D J Warwick Simpson Volume 71: A Practical Guide for Studying ... for Chuas circuit, the chapter presents several alternative hybrid realizations of Chuas circuit combining circuit topologies vii viii A Practical Guide for Studying Chuas Circuits proposed for...
Ngày tải lên: 12/12/2013, 08:29
Activity based cost systems for management
... emphasis on developing modern cost management systems for its manufacturing plants Therefore, the manufacturing plants lacked the cost management information that was needed to support the improvement ... Activity-Based Cost Systems for Management In some instances, a company may question whether the time spent in packaging is value-added Packaging is essential for some products but unnecessary for others ... (June 1989), p 63 For additional information, see Mike Walker, “Attribute Based Costing,” Australian Accountant (March 1992), pp 42–45 147 Chapter Activity-Based Cost Systems for Management DETERMINING...
Ngày tải lên: 18/12/2013, 09:12
Tài liệu A PARENTS’ HANDBOOK FOR Sickle Cell Center docx
... sickle cell center for exams, ask for more information Help Your Child Take Care Of Himself Children with sickle cell disease need to learn to things for themselves Sometimes, it is hard for parents ... Chapter ♦ KEY GUIDELINES FOR PARENTS K ey Guidelines for Parents Most children with sickle cell disease can look forward to a full life It is important that they be prepared for adulthood and living ... Chapter ♦ KEY GUIDELINES FOR PARENTS Key Guidelines for Parents See Appendices A and B for answers to the questions “What is Sickle Cell Disease?” and “What Causes Sickle Cell Disease?” Prevent...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu WHO''''S GOT THE POWER? TRANSFORMING HEALTH SYSTEMS FOR WOMEN AND CHILDREN pptx
... gender equality and empowering women Task Force on Child Health and Maternal Health Who’s got the power? Transforming health systems for women and children Task Force on HIV/AIDS, Malaria, TB, and ... Project task forces The task forces have identified the interventions and policy measures needed to achieve each of the Goals In Who’s Got the Power: Transforming Health Systems for Women and ... indicators for child health and maternal health Task force approach to health systems 13 Proposed targets and indicators for the child health and maternal health Goals 17 1.1 Task force approach...
Ngày tải lên: 12/02/2014, 23:20
Tài liệu DECISION SUPPORT SYSTEMS FOR BUSINESS INTELLIGENCE pptx
... appropriate information and models for informed decision making is to use decision support systems (DSS) Decision support systems are computer-based systems that bring together information from ... includes an understanding of the differences in preferences for models and model management systems and for trade-offs and mechanisms by which information is communicated and acted upon Since future ... discuss the methods for solution of mathematical models While accurate solution methods for mathematical models are important for a successful DSS, there is much more about the models that needs...
Ngày tải lên: 14/02/2014, 12:20