a land transformation model for the saginaw bay watershed

... together such that the final output takes the uncertainty in both steps together The approaches proposed by Ramshaw & Markus and Cardie&Pierce are deterministic and local, while Argamon, Dagan ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown...

Ngày tải lên: 08/03/2014, 05:20

... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... panel-data analytic techniques As more years of data on individual vehicles become available, it may be advantageous to adopt a panel-data approach 8 Improving Recapitalization Planning: Toward a Fleet ... Recapitalization Planning: Toward a Fleet Management Model for the HMMWV Table 4.1 Fleet Management Model Assumptions in Sensitivity Analyses and Base Case Replace Earlier Base Case Replace Later...

Ngày tải lên: 15/03/2014, 21:20

... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... result in a gain for others The optimal management of shared stocks is an area that requires collaborative effort among the littoral nations of the Bay of Bengal and the Andaman Sea Demersal fish ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...

Ngày tải lên: 06/03/2014, 15:21

... wave  breaking  on  a natural  beach  To  verify  the accuracy  of  the numerical  model on  the simulation  of  the wave  transformation on  a natural  beach,  existing  experimental data on the wave dynamics in  ... of  various  wave  characteristics,  it  can  be  remarked  that  the numerical  model can  simulate  wave  transformation in  the nearshore  region  with  an acceptable accuracy.  006 005 ... wave  dynamics  in  the near  shore  area  and  in  the vicinity  of  coastal  structures.  It  has  been  found  that  the numerical  model can  satisfactorily  simulate  the wave  transformation,  ...

Ngày tải lên: 28/03/2014, 15:20

... Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... both qualitative and quantitative, are captured by the model For example, the model accounts well for the diminished burst (i.e the disappearance of the maximum) at low S0 (below 510 lm) In these...

Ngày tải lên: 28/03/2014, 23:20

... snoitaraperp eniccaV sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi ... tneiciffeoc noitalerroC sisylana lacitsitatS )ASU ,eciveD raluceloM( redaer ASILE na gnisu mn 504 ta derusaem saw eulav D.O eht ,erutarepmet moor ta noitabucni fo nim 02 retfA etalp eht ot )ASU ,daR-oiB( ... ,retneC laminA yrotarobaL( ecim elamef c/BLAB dlo-keew-eviF snoitcelloc elpmas dna noitazinummi ,slamina latnemirepxE ]91,81[ yduts siht ni eniccav laro na sa desu dna debircsed ylsuoiverp sa deraperp...

Ngày tải lên: 07/08/2014, 18:21

... of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket...

Ngày tải lên: 11/08/2014, 20:21

... by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been correlated to actual patient ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... regulator of the apoptotic pathway such as caspase-3 was also evaluated immunohistologically to study the induction of apoptosis For the cell lines, druginduced expression of caspase-3 was analyzed...

Ngày tải lên: 12/08/2014, 15:20

... £30,000/QALY Page 12 of 14 Another limitation relates to the available vaccine efficacy data Firstly, as the SPS trial did not include patients aged 50 to 59, the model assumed that the efficacy values ... [11] Validation Once the model had been developed, it was validated by comparison to the available clinical data Using the clinical information from the SPS trial comparing vaccine with placebo ... were available for mild, moderate, and severe pain associated with HZ and PHN Alternative utility values, based on an HZ population, were available from Bala et al [29] and the SPS [15] For both...

Ngày tải lên: 13/08/2014, 11:22

... the ACC Paradigm paper With the understanding that there is a great deal of room for qualification, clarification, and interpretation, we believe that Palmer's postulates capture the essential ... theory A theory is an explanation It is an effort to explain and make understandable a set of observations or facts that are otherwise confusing, paradoxical, or self-contradictory in some way, and ... musculoskeletal pain complaints, the overwhelming majority of which are spine related A small subset, approximately 5%, of patients have headache as a primary complaint Any reasonable estimate would place...

Ngày tải lên: 13/08/2014, 13:22

... at 28°C, Wyngaarden and Greenland [6] at 25°C, and Kang and Fromm [9] at 22°C However, in the present work we did not look at temperature as a factor Conclusion The proposed model for the reaction ... different The adequacy of the model was ensured by comparing the theoretical calculations and the experimental data from the literature sources that were not used while the fitting procedure was under ... ppGpp This model describes the effect of the inhibitor as the above model does, so only the apparent inhibition constants were calculated In addition, the calculated values of these apparent inhibition...

Ngày tải lên: 13/08/2014, 16:21

... modelling, statistical analysis, drafting of the manuscript; PP: mathematical modeling; 18 ADG: mathematical modeling, drafting of the manuscript; 19 All authors read and approved the final manuscript ... sensitivity The present work therefore shows that the statistical, mathematical and physiological design features of the SDM actually translate, when the model is applied to data, into meaningful, ... 160' and 180' through the contralateral arm vein Each sample was immediately centrifuged and plasma was separated Plasma glucose was measured by the glucose oxidase method (Beckman Glucose Analyzer...

Ngày tải lên: 13/08/2014, 16:21

... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 3 2 1 ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...

Ngày tải lên: 13/08/2014, 16:21

... vertebrate proto-karyotype Nature 2004, 431:946-957 Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B, Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada A, Toyoda A, Kuroki ... analyses KR, UG, KS, MaS, AC, CE and MP contributed to writing the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available ... Fujiyama A, Sasaki T, Shimizu A, Asakawa S, Shimizu N, Hashimoto S, Yang J, Lee Y, Matsushima K, Sugano S, Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, et al.: The medaka draft genome and...

Ngày tải lên: 14/08/2014, 21:20

... classification standards: since the maintenance area spans over a wide range and has plenty of contents, the research papers on maintenance cannot be always covered by those purely mathematical ... Maintenance; Maintenance Planning and Production Joint Models; Maintenance Management; Maintenance Application and practical Examples; and Techniques associated to Maintenance Chapter Review on Maintenance ... Replacement with faulty parts Imperfect maintenance has been studied ever since the early stage that the area of maintenance arose as an academic field, so the large number of accumulated papers...

Ngày tải lên: 16/09/2015, 14:04

... Ontario, Canada Baltimore, USA England and Wales Netherlands West Germany Poland USA Netherlands England and Wales Nairobi, Kenya Kampala, Uganda Hong Kong Ontario, Canada Singapore Vietnam Time ... infectious diseases and their methods are also applied to real data Although the mathematical models are elegant, there are still some reasons that more practical statistical models should be ... we check the validation of the TSIR model and investigate the relationship between the parameters in the TSIR model and the classical mathematical epidemic model Next, based on the TSIR model, ...

Ngày tải lên: 26/09/2015, 09:57

... pavement performance database is a relational database originally implemented in Oracle format A relational database means that it is composed of separate, but related tables of data The importance ... specific analytical objectives The pavement performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement ... used for the data analysis The Transportation Research Board (TRB) of the National Research Council, under the sponsorship of the Federal Highway Administration (FHWA) and with the cooperation...

Ngày tải lên: 04/07/2016, 17:20

... changes from the normal, steady-state value The output variable is the variable of immediate concern, here V2 Changes in the output variable are caused by changes in the input variable, VI On the ... boundary and the boundary variables are treated as P0 / -S primal events The unit models describe both normal and failed behavior and depend on a wide variety of operating parameters and failure ... the overall action is Overpower the on the other branch Disturbance :^',k''' *iA^^>, NFFL that of a NFFL, namely the disturbances propagate down NFFL with a that enters the start Normal, manafter...

Ngày tải lên: 03/01/2014, 19:37

... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... cosubstrate NADPH For isomerization of fructose 6-phosphate, phosphoglucoisomerase was added 516 Mathematical modelling, parameter identification and simulation A mathematical model was developed, ... long-distance transport for acclimation The requirement for photosynthetic activity has also been demonstrated [21], and it was shown that acclimation does not take place in total darkness Strand et al...

Ngày tải lên: 14/02/2014, 22:20

... have to be evaluated on a case by case basis to calculate the exact costs or savings produced by the various interacting variables Consequently, there is a need for an interactive computer model ... only) For the purposes of the model, some assumptions or forecasts have to be made about the future behavior of the market interest rate Examples are (a) a worst case scenario (where the market ... customized, market interest rate assumptions can readily be made as appropriate Information about the old bond and the new bond Specifically, for both bonds: the face value; the term to maturity; the...

Ngày tải lên: 15/02/2014, 13:20