Identification and biochemical characterization of tetrahydrolipstatin targets in m bovis BCG at different metabolic states

... transform-mass spectrometry m/ z mass by charge ratio MAG Monoacylglycerol MBC Minimal bactericidal concentration MIC50 Minimum inhibitory concentration required to inhibit the growth of 50% of organism ... and ineffective against latent bacilli20 As of 2010, the recommended treatment for active TB is minimum six months of a combination of four antibiotics containing rifampicin,...

Ngày tải lên: 09/09/2015, 10:07

... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and...

Ngày tải lên: 09/09/2015, 10:17

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...

Ngày tải lên: 19/02/2014, 02:20

... by semiquantitative analysis of transcripts by Northern blotting and also by quantification of the enzyme protein by Western blotting Expression of Pf MDH, Pf LDH and Pf MQO in control and drug ... and purity of RNA the gels were stained with ethidium bromide and visualized on a UV transluminator Equal intensity of ribosomal RNA bands in all of the lanes ind...

Ngày tải lên: 16/03/2014, 18:20

... regulatory questions in the actively multiplying tachyzoite, as any given population of cells in culture consists of parasites at different points of their cell cycle Our study reports the presence of ... a majority of the bases in each motif were substituted by base-specific transversions, thus destroying the original sequence of the candidate motif but maintainin...

Ngày tải lên: 14/08/2014, 21:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...

Ngày tải lên: 19/02/2014, 06:20

... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclud...

Ngày tải lên: 22/02/2014, 07:20

... describe the first purification of human recombinant kynureninase to homogeneity The protein was fully Fig Inhibition of kynureninase activity by L-kynurenine as a function of 3-hydroxykynurenine concentration ... regulation of enzyme activity in vivo and consequent channeling of substrate 3-hydroxykynurenine down the tryptophan– kynurenine metabolic pathway The p...

Ngày tải lên: 08/03/2014, 22:20

... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range f...

Ngày tải lên: 08/03/2014, 22:20

... alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction ... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and...

Ngày tải lên: 16/03/2014, 16:20

... particular, the biochemical aspects of the 3-HK dependent synthesis of XA in Anopheles gambiae, the most efficient vector of the most deadly malaria parasite P falciparum, remain elusive We report here the ... than that of the A gambiae enzyme ( lmolÆ min)1Æmg)1) The possible physiological ⁄ functional significance and the implications of these differences be...

Ngày tải lên: 16/03/2014, 23:20

... Values of kcat and K are independent of the enzyme assay m Biosynthesis of N-amidino-2-hydroxypyrrolidine N-Amidino-2-hydroxypyrrolidine was synthesized as follows Twenty micrograms of P sativum copper ... of agmatine to N-amidino-2hydroxypyrrolidine was detected by 1H-NMR spectroscopy Moreover, the agmatine/ N-amidino-2-hydroxypyrrolidine stoichiometry is : as shown...

Ngày tải lên: 17/03/2014, 23:20

... were eluted in two phases with 300 mL of linear gradient of 0–0.6 M NaCl and 50 mL of linear gradient of 0.6–1 M NaCl at a flow rate of 0.8 mLÆmin)1 Fractions of mL were collected and those displaying ... results of studies leading to the conclusion that at least two distinct soluble enzymes of P denitrificans exhibit an activity of Fe(III) reductase These enzymes...

Ngày tải lên: 30/03/2014, 13:20

... M and Collins, M D Molecular taxonomic Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis 223 studies on Streptococcus uberis types I and ... profile using the restriction enzymes RsaI and AvaII RFLP analysis of the 16S rRNA gene had Identification and epidemiological characterization of Strept...

Ngày tải lên: 07/08/2014, 17:22

... fundamentally to such studies in two ways: firstly by enriching the ISfinder database by high throughput annotation of completely assembled and scaffold-based genomes; and secondly by direct analysis of ... and e-value 1e-5) analysis, which yields an IS prediction and generates a webbased annotation table If no ORFs are found, BLASTN is performed against the ISfind...

Ngày tải lên: 09/08/2014, 22:24