Pathomechanistic characterization of DMT1 mediated manganese

Pathomechanistic characterization of DMT1 mediated manganese cytotoxicity implications in neurodegeneration

... expressed in almost every population of cells in the brain, these results indicate the importance of DMT1 in mediating iron transport in the brain In addition, as an example of DMT1 mutation in human, ... expression of DMT1 was also found in the astrocytic end feet, suggesting the involvement of DMT1 in iron uptake from the endothelial cells lining of the B...

Ngày tải lên : 08/09/2015, 19:15

233
435
0

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... 1 H NMR of mobile lipids in tumour cells A M Luciani et al MCF-7 cells from human cancers In a previous study [13], we demonstrated that these cells display intensity modulation of ML signals ... provided in Fig 1B (insert), which shows the characteristic cross peak from the geminal protons of carbons and of glycerol in TG [1] Cross peaks of lipids, includ...

Ngày tải lên : 18/02/2014, 13:20

14
765
0

Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

... (S)-cheilanthifoline, not (S)-nandinine [7,30,31] If we assume that (S)-nandinine is produced in E californica, there may be no need for a catalyst from (S)-nandinine to (S) -stylopine However, nandinine could ... 1029 Stylopine synthase from Eschscholzia californica N Ikezawa et al E californica [27] Indeed, CYP80B1 has been cloned using this strategy, although other P450s invol...

Ngày tải lên : 07/03/2014, 10:20

17
376
0

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... product of the second round of PCR was cloned and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acids of the B-chain of the ml gene was obtained ... (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricin B-chain Leu152; and Met234 of the ML1p and...

Ngày tải lên : 07/03/2014, 15:20

11
610
0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên : 07/03/2014, 16:20

12
772
0

Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

... within negatively stained particles of artemin indicated the lack of metal storage capacity Function of an Artemia ferritin homolog A B C Artemin, apoferritin and ferritin inhibit citrate synthase ... denaturation Artemin, apoferritin and ferritin protected citrate synthase against denaturation at 43 °C in a concentrationdependent manner (Fig 3A C) Maximal protec...

Ngày tải lên : 16/03/2014, 11:20

9
434
0

Báo cáo khoa học: Characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans docx

... the identiﬁcation and characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans We show that these enzymes are heterotetramers, like the decaprenyl diphosphate synthase ... synthases in mice and humans need two proteins (i.e both mSPS1 and mDLP1 or both hDPS1 and hDLP1, respectively) to be active The success of reconstitu...

Ngày tải lên : 16/03/2014, 23:20

17
346
0

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... kept at °C and used within 10 days Quantification of alkaline phosphatase and aminopeptidase activities Specific alkaline phosphatase (ALP) and N-aminopeptidase (APN) enzymatic activities of BBMV ... sugar Canavalis ensiformis (ConA) a- Man a- Glc Galb1 fi 3GalNAc Galb1 fi 3,4GlcNAc a/ bGalNAc a/ bGal Galb1 fi 4GlcNAc Gala1 fi 3Gal GalNAca1 fi 3GalNAc GalNAca1 fi 3Gal Galb1 fi 3G...

Ngày tải lên : 23/03/2014, 13:20

9
399
0

Báo cáo khoa học: Quenched hydrogen ⁄deuterium exchange NMR characterization of amyloid-b peptide aggregates formed in the presence of Cu2+ or Zn2+ ppt

... to morphologically distinguish aggregates formed in the presence of Cu2+ from those formed in the presence of Zn2+ Taken together, these results suggest that Ab aggregates formed in the presence ... aggregates formed in the presence of Cu2+ [(i) and (iii)] or Zn2+ [(ii) and (iv)], or as ﬁbrils formed in the presence of EDTA [(v...

Ngày tải lên : 30/03/2014, 01:20

10
294
0

Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

... designated P2Y12 [15–17] Results from our laboratory revealed that both classic P2Y1 and P2Y12 receptors coexist in glioma C6 cells: P2Y1, linked to phospholipase C, and P2Y12 , inhibiting adenylate ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of speciﬁc pharmacological agents (a single agonist a...

Ngày tải lên : 30/03/2014, 08:20

13
378
0

Báo cáo khoa học: Biochemical characterization of the minimal polyketide synthase domains in the lovastatin nonaketide synthase LovB pot

... that the individual domains of the megasynthase may remain folded despite the lack of the KS dimer Minimal polyketide synthase domains in LovB Characterization of the standalone MAT protein The LovB ... in the yield of the soluble protein Pantetheinylation of the ACP in ACPCON didomain was veriﬁed using MALDI-TOF of a tryptic fragment of...

Ngày tải lên : 30/03/2014, 08:20

11
558
0

Báo cáo hóa học: " Chemical characterization of extra layers at the interfaces in MOCVD InGaP/GaAs junctions by electron beam methods" ppt

... sublayer of the nominal GaAs QW, it results in either In 0.05 Ga 0.95 As 0.84 P 0.16 or GaAs 0.91 P 0.09 by the same procedure The TEM results indicating the formation of InGaAsP at the location of the ... showing that the growth of a thin GaP layer on the top of InGaP, before GaAs is grown, is effective in preventing the formation of the quaternary i...

Ngày tải lên : 21/06/2014, 05:20

7
387
0

Báo cáo khoa học: "The expression of plasmid mediated afimbrial adhesin genes in an avian septicemic Escherichia coli strain" doc

... 13 and had the insertion of the transposon in this plasmid as indicated by the plasmid profile and hybridization experiments Previous studies Expression of afimbrial adhesion genes in avian septicemic ... transformant strains and the reference plasmids Lane 1: Strain V517 (32 MDa), Lane 2: Strain SEPT13, Lane 3: Strain ST16, Lane 4: Recipient strain MS101 harboring the 9...

Ngày tải lên : 07/08/2014, 20:23

9
325
0

Báo cáo y học: "proteomic characterization of non-small cell lung cancer in a comprehensive translational thoracic oncology database" docx

... Cite this article as: Surati et al.: Proteomic characterization of non-small cell lung cancer in a comprehensive translational thoracic oncology database Journal of Clinical Bioinformatics 2011 ... staining of one core of a TMA to that of a control core on the same slide A score of indicates faint staining, indicates medium intensity staining, and indic...

Ngày tải lên : 10/08/2014, 09:22

11
335
0

báo cáo khoa học: " Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana" pdf

... are indicated in lower case Overlapping sequences found in deletion sites are highlighted in bold Inserted sequence is highlighted in bold and Italic - 28 - Table Classification of mutations induced ... Local Lesions in Genomes (TILLING) [5-9] Because of its mutation-inducing property, EMS is also very useful for producing leaky alleles in forward genetics By contrast, X-rays...

Ngày tải lên : 11/08/2014, 11:21

35
232
0