Báo cáo khoa học: Biochemical characterization of the minimal polyketide synthase domains in the lovastatin nonaketide synthase LovB pot

Biochemical characterization of the minimal polyketide synthase domains in the lovastatin nonaketide synthase LovB Suzanne M. Ma and Yi Tang Department of Chemical and Biomolecular Engineering, University of California, Los Angeles, CA, USA Lovastatin is a polyketide metabolite produced by the filamentous fungi Aspergillus terreus and is an efficient inhibitor of 3-hydroxy-3-methylglutaryl coenzyme A (CoA) reductase, the enzyme that catalyzes the rate- limiting step in cholesterol biosynthesis [1]. Among the enzymes that biosynthesize lovastatin are two poly- ketide synthases (PKS) and numerous accessory enzymes (Fig. 1) [2]. The two megasynthases are the lovastatin nonaketide synthase (LovB, 335 kDa) and lovastatin diketide synthase (LovF, 277 kDa), which catalyze the assembly of the decalin core and the 2-methylbutyrate side chain, respectively (Fig. 1). Both LovB and LovF are multidomain enzymes with domain architectures and activities related to animal fatty acid synthases (FAS) and bacterial type I PKS. Central to PKS and FAS are the minimal catalytic Keywords filamentous fungi; ketosynthase; lovastatin; megasynthase; polyketide Correspondence Y. Tang, Department of Chemical and Biomolecular Engineering, 5531 Boelter Hall, 420 Westwood Plaza, UCLA, Los Angeles, CA 90095, USA Fax: +1 310 206 4107 Tel: +1 310 825 0375 E-mail: yitang@ucla.edu (Received 1 March 2007, revised 29 March 2007, accepted 2 April 2007) doi:10.1111/j.1742-4658.2007.05818.x The biosynthesis of lovastatin in Aspergillus terreus requires two mega- synthases. The lovastatin nonaketide synthase, LovB, synthesizes the inter- mediate dihydromonacolin L using nine malonyl-coenzyme A molecules, and is a reducing, iterative type I polyketide synthase. The iterative type I poly- ketide synthase is mechanistically different from bacterial type I polyketide synthases and animal fatty acid synthases. We have cloned the minimal polyketide synthase domains of LovB as standalone proteins and assayed their activities and substrate specificities. The didomain proteins ketosyn- thase-malonyl-coenzyme A:acyl carrier protein acyltransferase (KS-MAT) and acyl carrier protein-condensation (ACP-CON) domain were expressed solubly in Escherichia coli. The monodomains MAT, ACP and CON were also obtained as soluble proteins. The MAT domain can be readily labeled by [1,2- 14 C]malonyl-coenzyme A and can transfer the acyl group to both the cognate LovB ACP and heterologous ACPs from bacterial type I and type II polyketide synthases. Using the LovB ACP-CON didomain as an acyl acceptor, LovB MAT transferred malonyl and acetyl groups with k cat ⁄ K m values of 0.62 min )1 Ælm )1 and 0.032 min )1 Ælm )1 , respectively. The LovB MAT domain was able to substitute the Streptomyces coelicolor FabD in supporting product turnover in a bacterial type II minimal poly- ketide synthase assay. The activity of the KS domain was assayed inde- pendently using a KS-MAT (S656A) mutant in which the MAT domain was inactivated. The KS domain displayed no activity towards acetyl groups, but was able to recognize malonyl groups in the absence of ceru- lenin. The relevance of these finding to the priming mechanism of fungal polyketide synthase is discussed. Abbreviations ACP, acyl carrier protein; CoA, coenzyme A; CON domain, condensation domain; 6-DEBS, 6-deoxyerythronolide B synthase; FAS, fatty acid synthase; KR, ketoreductase; KS, ketosynthase; MAT, malonyl-CoA:ACP acyltransferase; NSAS, norsolorinic acid synthase; PKS, polyketide synthase. 2854 FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS domains [3], consisting of the ketosynthase (KS) that performs decarboxylative claisen condensation for chain elongation [4]; the malonyl-CoA:ACP acyltrans- ferase (MAT) that selects and transfers the extender unit in the form of malonic esters; and the acyl carrier protein (ACP) that serves as the tether for the extender unit and the growing chain. In addition, tailoring enzymes such as ketoreductase (KR), dehydratase, methyltransferase and enoylreductase modify the car- bon backbone and introduce structural diversity [5]. LovB was first identified by Hendrickson et al. [6] and reconstituted in Aspergillus nidulans by Hutchinson and Vederas [2]. It is a reduced iterative PKS that is mechanistically different from the modular, bacterial type I PKS, such as the well-characterized 6-deoxy- erythronolide B synthase (6-DEBS). The minimal PKS domains in LovB are used repeatedly to synthesize the nonaketide decalin core from nine malonyl-CoA units (Fig. 1). Varying degrees of polyketide tailoring modifi- cations are performed after each condensation step by a different combination of LovB catalytic domains (inclu- ding the dissociated enoylreductase, LovC) [2] to afford the key intermediate dihydromonacolin L. LovB also contains a C-terminus domain with sequence similarity to a nonribosomal-peptide synthase condensation (CON) domain. The function of the CON domain in di- hydromonacolin L biosynthesis is not known. Whereas the colinearity rule of modular type I PKS allows pre- diction of product structure from primary domain arrangements [7], iterative PKS such as LovB use an unknown set of programming rules and the sequence of catalytic events are difficult to decipher from examining domain sequences alone [8]. Elucidating the biochemi- cal properties and substrate specificities of individual domains are therefore important in understanding the underlying mechanisms of fungal PKS megasynthases, predicting polyketide products from protein sequences, and engineering biosynthesis of novel polyketides. Biochemical studies and engineering of the fungal megasynthases are more difficult than the bacterial counterparts for several reasons. First, the intrinsic size of these megasynthases poses a significant barrier to the isolation and characterization of these enzymes. Heterologous expression of intact PKS are generally performed in evolutionarily closely related fungal hosts such as A. nidulans [2,9] and Aspergillus oryzae [10]. Second, the iterative nature of the PKS renders each domain indispensable during chain elongation. Approaches such as domain inactivation, mutasynthe- sis and precursor directed biosynthesis are ineffective in probing domain specificities and sequences of cata- lytic events. Recent refinement of fungal genetic tech- niques has allowed construction of PKS mutants and hybrid synthases [11], with the notable example of KS swapping between heterologous fungal megasynthases [12]. Nevertheless, these manipulations are difficult to perform and are time-consuming. Reconstitution of the catalytic domains as individual enzymes has been successful in analyzing the biochemi- cal and structural features of animal FAS [13] and bac- terial type I PKS, including the KS-AT [14,15], KR [16], ACP [17], and thioesterase domains [18–20] from 6-DEBS. This strategy is especially attractive in study- ing iterative PKS because the activities and substrate specificities of individual domains can be probed sepa- rately. For example, Crawford and Townsend [21] used KS MAT DH MT KR ACP CON KS MAT DH MT ER KR ACP ER KS MAT DH MT KR ACP CON KS MAT DH MT KR ACP CON KS MAT DH MT KR ACP CON KS MAT DH MT KR ACP CON KS MAT DH MT ER KR ACP OH HO COOH OH Monacolin J acid OH HO COOH O O LovF LovB CYP P450 Lovastatin acid Dihydromonacolin L OH HO COOH LovC S O SH S S SOH O OH O Diels-Alder Reaction SH SH 4 X Malonyl-CoA 2 X Malonyl-CoA 3 X Malonyl-CoA O 2 X Malonyl-CoA PKS Release O LovD Fig. 1. Biosynthetic pathway for lovastatin in A. terreus. LovB is the lovastatin nonake- tide synthase that synthesizes dihydromo- nacolin L together with the dissociated enoylreductase LovC. Dihydromonacolin L is oxidized to monacolin J by one or more cytochrome P450 enzymes. LovF is the lovastatin diketide synthase that synthesizes 2-methylbutyry-S-LovF. The side chain is transferred by LovD to monacolin J to yield lovastatin. Domain abbreviations: KS, keto- synthase; MAT, malonyl-CoA:acyl carrier protein transacylase; ACP, acyl carrier pro- tein; DH, dehydratase; ER, enoylreductase; MT, methyltransferase; KR, ketoreductase; CON, possible condensation domain. S. M. Ma and Y. Tang Minimal polyketide synthase domains in LovB FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS 2855 the UWA algorithm to clone and identify the function of the starter unit:ACP transacylase domain from norsolorinic acid synthase (NSAS) involved in afla- toxin biosynthesis [22]. Recently, Ma et al. [23] demon- strated that the standalone NSAS ACP domain can function as the ACP component of a bacterial minimal PKS in vitro. In this study, we have cloned the minimal PKS domains from LovB and isolated them as standalone mono- and didomains. We characterized the activities of the KS and MAT domains in detail and examined the interactions between the core catalytic units with the cognate and heterologous ACP domains. Further- more, we assayed the substrate specificities of the KS and MAT domains to highlight similarities and funda- mental differences between theses domains embedded in bacterial PKS, fungal PKS, and animal FAS. Results and Discussion Expression of minimal PKS domains To explore the activities of the KS, MAT and ACP domains of LovB (Fig. 2), we proceeded to construct expression vectors that contained excised mono- and didomains. Putative domain boundaries were identified through sequence alignment with bacterial type I PKS as well as mammalian and fungal FAS, and are indi- cated in Fig. 2(B). PCR primers were designed to amplify the targeted domains based on the designated boundaries. The template of the PCR reaction was the complete, uninterrupted reading frame of LovB, which was obtained by removing the seven introns using splice by overlap extension PCR. We constructed pET28a(+) derived expression vectors for the KS- MAT didomain, the ACP monodomain, the CON monodomain and the ACP-CON didomain (Table 1). The KS-MAT (pSMA30) and CON (pSMA61) expres- sion constructs were transformed into BL21(DE3) for protein expression, whereas the ACP-containing constructs were transformed into BAP1 for phospho- pantetheine modification of the ACP domain with the broad spectrum phosphopantetheinyl transferase gene sfp from Bacillus subtilis [24]. The KS-MAT didomain can be expressed at very high levels (approximately 20 mgÆL )1 ) when the His-tag is appended at the C-terminus. The KS-MAT can be purified to homogeneity by nickel affinity chromato- graphy followed by anion exchange chromatography. N-terminus His-tag fusion resulted in significant AB Fig. 2. (A) Domain organization of LovB and the standalone domains studied in this work. SDS ⁄ PAGE of purified proteins assayed: lane 1, LovB KS-MAT (103 kDa); lane 2, LovB KS-MAT (S656A); lane 3, LovB KS-MAT (S657A); lane 4, LovB MAT (52 kDa); lane 5, LovB MAT (S208A); lane 6, LovB ACP-CON (66 kDa); lane 7, LovB ACP (11 kDa); lane 8, DEBS M3 ACP (11 kDa); lane 9, DEBS M6 ACP (11 kDa); lane 10, ZhuN (10 kDa). (B) Amino acid sequence of the LovB megasynthase and domain boundaries. Shaded regions indicate the individual catalytic domains identified through sequence homology with the fatty acid synthase. The active site residues of KS, MAT and ACP are underlined. Minimal polyketide synthase domains in LovB S. M. Ma and Y. Tang 2856 FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS aggregation of the protein into inclusion bodies. Com- pared to bacterial modular PKS, the N-terminal of LovB does not contain the coiled-coil linkers crucial for module–module communication. By contrast, the N-ter- minal sequence (P10IVVVGSGCR19) of LovB KS is well aligned with the residues (P40IAIVGMACR49) that form the first b -sheet of DEBS M5 KS-MAT dimer [14]. Therefore, it is plausible that an N-terminus His-tag may interfere with the folding of the KS core. The ACP domain of NSAS, an iterative, nonreducing PKS from Aspergillus parasiticus, was recently expressed as a standalone protein [23]. Although the ACP domain boundary differed for the reducing LovB PKS, both the ACP (1 mgÆL )1 ) and the ACP-CON didomain (15 mgÆL )1 ) can be expressed solubly as N-terminal His- Tag proteins (Fig. 2A). Complete pantetheinylation of the active site serine can be confirmed by MALDI-TOF analysis (Observed: 12225; Expected: 12221; Apo form: 11881). Appending the CON domain to the ACP domain resulted in a 15-fold increase in the yield of the soluble protein. Pantetheinylation of the ACP in ACP- CON didomain was verified using MALDI-TOF of a tryptic fragment of the purified protein (data not shown). The LovB CON domain can also be expressed as a standalone protein when cloned using the boundar- ies shown in Fig. 2(B) (data not shown). In addition to LovB ACP and LovB ACP-CON, we also purified four heterologous ACP domains for bio- chemical analysis of KS:ACP and MAT:ACP inter- actions. We expressed the holo-forms of DEBS M3 ACP and M6 ACP (domains from bacterial type I PKS) [15], as well as ZhuN [25] and OxyC [26] (standalone ACPs from type II PKS) using BAP1 (Fig. 2A). Each of these proteins was purified using Ni-nitrilotriacetic acid chromatography and were verified by MALDI-MS. Biochemical characterization of the LovB KS-MAT didomain Equipped with soluble forms of the LovB KS-MAT didomain and standalone ACP domains, we assayed the catalytic properties of the didomain, as well as interactions between the minimal PKS components. Figure 3A shows the labeling of LovB KS-MAT by [1,2- 14 C]malonyl and [1- 14 C]acetyl-CoA. We expected the radioactive acyl substrate to reside either on the active site cysteine of the KS domain through thioester exchange or on the active site serine of the MAT domain through esterification. Under identical condi- tions (10 lm KS-MAT, 0 °C, 10 min), more than 70% of the didomain was labeled by [ 14 C]malonyl-CoA, but only approximately 5% of the protein was labeled with [ 14 C]acetyl-CoA. To examine the LovB KS–MAT interaction with the dissociated ACP domain, we incubated the LovB ACP and LovB ACP-CON didomain with the KS-MAT (5 lm) in the presence of either [ 14 C]malonyl-CoA or [ 14 C]acetyl-CoA (Fig. 3B). When malonyl-CoA was used as the acyl donor, both the ACP and the ACP-CON didomain can be readily labeled, con- firming the interaction between the dissected KS-MAT and ACP domains remained intact (Fig. 3B). Inter- estingly, although the ACP and ACP-CON didomain were supplied at the same molar amounts (10 lm), the steady state labeling of the ACP-CON domain was approximately six-fold higher than that of the ACP domain. To probe whether there are additional sites for acylation in the CON domain, we performed an acyltransfer assay using the CON domain alone. No labeling can be observed when the CON domain or the apo-ACP-CON didomain was used in the Table 1. PCR primers used for amplification and mutation of DNA encoding the LovB KS-MAT didomain, LovB ACP, and LovB ACP-CON didomain. The introduced restriction sites and mutation sites are underlined. Gene Plasmid Primers (5¢) to 3¢) LovB KS-MAT pSMa30 AA CATATGGCTCAATCTATGTATCCTAATG AATCAGGGGCGAGTTGC TCTAGATTCCACCCAGTAGCGACGAGAG LovB ACP pSMa7 AA CATATGCTCTTGCAGGCAGACGAACCTG AATTAGGAGCTAGGTGGCAATCGCGCAGCAG LovB ACP-CON pSMa8 AA CATATGCTCTTGCAGGCAGACGAACCTG AATCATGCCAGCTTCAGGGCGGGATTC LovB CON pSMa61 AA CATATGGTCGCAGCCACCGACGGGGG AATCATGCCAGCTTCAGGGCGGGATTC LovB MAT pSMa73 TT CCATGGAGCCAGAGCAAAACCAG AATCAGGGGCGAGTTGC TCTAGATTCCACCCAGTAGCGACGAGAG LovB MAT (S208A) ⁄ pSMa70 ⁄ GGCTCTTGTTGGACAT GCTAGCGGCGAAATTGCTTG LovB KS-MAT (S656A) pSMa36 CAAGCAATTTCGCCGCTA GCATGTCCAACAACAGCC LovB MAT (S209A) pSMa71 CTGTTGTTGGACATAGC GCTGGCGAAATTGCTTGCG CGCAAGCAATTTCGCC AGCGCTATGTCCAACAACAG S. M. Ma and Y. Tang Minimal polyketide synthase domains in LovB FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS 2857 acyltransfer assay, confirming the malonyl group was indeed only transferred to the active site phosphopant- etheine thiol of the ACP domain. The increase in labe- ling of the ACP-CON didomain may be a result of improved folding of the ACP domain when attached to the larger CON domain, which can also explain the increase in soluble protein yield; or enhanced acyl- transfer rate as a result of more extensive protein–pro- tein interactions between the dissociated didomains. The LovB KS-MAT didomain displayed broad speci- ficity towards heterologous ACPs in the acyltransfer reaction and transferred the malonyl group to all ACPs to a comparable extent (Fig. 3B). The KS-MAT didomain also transferred [ 14 C]acetyl to both ACP and ACP-CON after 30 min of incubation (Fig. 3B, lanes 6 and 7). The steady state amount of acetyl- ACP-CON was approximately 20% that of malonyl- ACP-CON. Isolation and cloning of standalone MAT domain To understand the relative contributions of the KS and MAT domains in selecting and transferring the acyl substrates shown in Fig. 3, we aimed to further dissect the KS-MAT didomain into individual cons- tituents. During nickel-affinity purification of the 103 kDa LovB KS-MAT didomain, a significant con- taminant protein with an apparent molecular mass of 45 kDa was copurified (Fig. 4A). We suspected the smaller protein may be a truncated MAT (C-term His- tag) domain that resulted from proteolytic cleavage at the boundary separating the KS and MAT domains. Proteolytic acyltransferase fragments have been previ- ously obtained from the rat FAS [27]. The 45 kDa protein can be readily labeled by [ 14 C]malonyl-CoA (Fig. 4A), demonstrating that it can form a covalent 66 55 42 116 kDa 66 55 42 116 kDa 1 LovB KS-MAT LovB MAT 212 158 97 kDa LovB “KS-less” LovB LovB MAT WT S208A S209A 23 12 3 123 4 A B C Fig. 4. (A) Identification of a MAT proteolytic fragment. Lane 1, SDS ⁄ PAGE of LovB KS-MAT(C-term His-tag) after Ni-nitrilotriacetic purification; lane 2, autoradiography of proteins in lane 1 after labe- ling with [ 14 C]malonyl-CoA; lane 3, SDS ⁄ PAGE of purified, cloned standalone MAT domain; lane 4, autoradiography of protein in lane 3 after labeling with [ 14 C]malonyl-CoA. (B) Loss of the KS frag- ment in the full length LovB. Lane 1, SDS ⁄ PAGE of LovB (C-term His-tag) after Ni-nitrilotriacetic showing two large proteins; lane 2, autoradiography of proteins in lane 1 after labeling with [ 14 C]malo- nyl-CoA; lane 3, autoradiography of proteins in lane 1 after labeling with [ 14 C]acetyl-CoA. (C) Examination of the active site serine of standalone MAT. [ 14 C]malonyl-CoA labeling of wild-type (lane 1), S208A (lane 2) and S209A (lane 3); 50 m M NaH 2 PO 4 ,pH¼ 7.4, 20 l M KS-MAT, 2 mM acyl-CoA, 0 °C , 10 min. A 1 2 KS-AT B 1 2 3 4 5 KS-MAT ACP-CON ACP 6 7 Fig. 3. (A) [1,2- 14 C]malonyl-CoA (lane 1) and [1- 14 C]acetyl-CoA labe- ling (lane 2) of the LovB KS-MAT, 50 m M NaH 2 PO 4 ,pH¼ 7.4, 10 l M KS-MAT, 2 mM acyl-CoA, 0 °C, 10 min 70% of KS-MAT is labeled by malonyl-CoA, whereas only 5% is labeled by acetyl-CoA. (B) Acyltransfer of [ 14 C]malonyl and [ 14 C]acetyl to ACPs in the pres- ence of LovB KS-MAT. Each ACP is performed in duplicate. [ 14 C]Malonyl-CoA: lane set 1, LovB ACP-CON; lane set 2, LovB ACP; lane set 3, DEBS M3 ACP; lane set 4, DEBS M6 ACP; lane set 5, ZhuN. [ 14 C]Acetyl-CoA: lane set 6, LovB ACP-CON; lane set 7, LovB ACP; 50 m M NaH 2 PO 4 ,pH¼ 7.4, 5 lM KS-MAT, 2 mM acyl-CoA, 10 lM ACP. 25 °C, 30 min. Minimal polyketide synthase domains in LovB S. M. Ma and Y. Tang 2858 FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS adduct with the malonyl acyl group. An additional anion exchange chromatography step was used to separate the two proteins in pure forms. N-terminal sequencing of the 45 kDa protein indicated it is indeed the standalone MAT domain. The truncation site is at EY448|M449EPEQ (N-terminal sequencing results are indicated in bold), which corresponds to a region that is highly conserved among fungal and bacterial type I PKS [28]. Examining the recently elucidated crystal structure of the 6-DEBS module 5 KS-AT suggested that this proteolytic site identified for LovB KS-MAT is at the beginning of a structurally highly ordered lin- ker region (approximately 100 amino acids) connecting and interacting with the KS and MAT domains [14]. Intriguingly, LovB KS-MAT is highly susceptible to proteolytic cleavage during cell lysis at this domain junction (Fig. 4A), but does not undergo further deg- radation after affinity and anion chromatography steps. By contrast, no apparent proteolysis of the DEBS M5 KS-AT [14] or the animal FAS KS-MAT [29] didomains were observed during purification. We then cloned the MAT domain using the sequence information obtained above and expressed it as a standalone protein from Escherichia coli. The recombinant MAT domain can be expressed at very high levels (approximately 50 mgÆL )1 ), be purified to homogeneity (Fig. 4A, lane 3) and can be labeled with [ 14 C]malonyl-CoA (Fig. 4A, lane 4). By con- trast, the standalone KS region cannot be isolated when expressed in E. coli. Expression of the LovB KS domain devoid of the MAT domain resulted in the formation of inclusion bodies, which was recently noted for the KS domains of other megasynthases [23]. Proteolytic cleavage of the KS domain was also observed for the entire LovB protein. When expressed with a C-terminal His-tag from BAP1, the entire megasynthase (335 kDa) can be expressed solubly at surprisingly high levels (Fig. 4B; 5 mgÆL )1 ). However, during Ni-nitrilotriacetic affinity purification, we observed an additional high molecular weight protein (approximately 290 kDa) coeluted with LovB. Incuba- tion of the purified proteins with [ 14 C]malonyl-CoA yielded strong labeling of both bands (Fig. 4B), sug- gesting the smaller fragment may contain an intact MAT domain, and is likely a ’KS-less’ LovB. The recent crystal structures of the animal FAS showed the importance of the dimeric KS in stabilizing the parallel FAS structure [30]. Our results with LovB, along with the observation of a recombinant ’KS-less’ FAS protein by Witkowski et al. [29], confirm that the individual domains of the megasynthase may remain folded despite the lack of the KS dimer. Characterization of the standalone MAT protein The LovB MAT active site region contains two con- secutive serine residues (GHS656S657G). The serine dyad occurs frequently among fungal PKS and is also found in the active site of the lovastatin diketide syn- thase LovF. This differs from FAS MAT and PKS AT, where the active site contains a single serine in a highly conserved GHSXG motif [31]. Although S656 is the putative nucleophile, it is unknown whether the second serine in the dyad can also participate in the acyltransfer reaction in LovB MAT. We constructed two mutant forms of the standalone MAT, S208A and S209A, to probe the relative contribution of both ser- ine residues. The amount of soluble protein obtained for the S208A mutant is comparable to the yield of the wild-type protein (approximately 50 mgÆL )1 ). By con- trast, the S209A mutant expressed poorly (2 mgÆL )1 ), suggesting the second serine contributes substantially to the overall folding and structural integrity of the catalytic domain. The wild-type MAT and the two mutants were incubated in the presence of [ 14 C]malonyl-CoA and protein labeling was visualized with autoradiography (Fig. 4C). The S208A mutant was devoid of any detectable labeling, whereas the S209A mutant was labeled, albeit weaker than the wild-type enzyme. We therefore concluded that S656 in LovB is absolutely essential for the catalytic activity of the LovB MAT domain and is the site of extender unit esterification. We then repeated the MAT:ACP acyltransfer experi- ment using the standalone LovB MAT domain. We incubated the MAT domain (5 lm) and various holo- ACP proteins (10 lm) with [ 14 C]malonyl-CoA for 30 min and the levels of acyltransfer were measured using autoradiography. The MAT domain displayed broad substrate specificity towards ACP domains and is capable of acylating all the heterologous ACP pro- teins examined (data not shown). Figure 5A compares the initial rates of acyltransfer catalyzed by the MAT domain using LovB ACP-CON as the acyl acceptor. MAT was able to transfer the malonyl group (K m ¼ 5.4 ± 1.5 lm; k cat ¼ 3.3 ± 0.16 min )1 ; k cat ⁄ K m ¼ 0.62 min )1 Ælm )1 ) almost 20-fold fas- ter than towards the acetyl group (K m ¼ 18.7 ± 1.6 lm; k cat ¼ 0.6 ± 0.014 min )1 ; k cat ⁄ K m ¼ 0.032 min )1 Ælm )1 ). The stronger preference of MAT towards malonyl- CoA is consistent with the differential extents of labeling observed in Figs 3(A) and 4(B). We then compared the substrate specificity of LovB MAT to the Streptomyces coelicolor malonyl-CoA:ACP transacylase (scFabD) [32]. Using ACP-CON as an acceptor, scFabD dis- played extremely rapid activity towards malonyl-CoA S. M. Ma and Y. Tang Minimal polyketide synthase domains in LovB FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS 2859 (k cat ¼ 396 ± 14 min )1 , K m not determined), whereas it remained completely inactive towards acetyl-CoA. The substrate selectivity of LovB MAT towards malonyl-CoA over acetyl-CoA therefore lies between that of bacterial FabD (malonyl only) [33] and that of the animal FAS MAT domain, which transacylates acetyl and malonyl unit with comparable kinetic parameters [13]. The FAS MAT employs acetyl unit selected by the MAT domain as the starter unit in fatty acid biosynthesis. During chain elongation, the FAS MAT uses a ’self-editing’ mechanism to rapidly remove the incorrectly charged acetyl moiety to an acyl acceptor, such as free CoA, to avoid stalling of the megasynthase [34]. When the FAS MAT domain was charged with the cognate malonyl unit, electro- static interaction between an arginine residue and the carboxylate anion of malonyl unit anchors the malonyl unit in the active site [35]. The conserved arginine can be found in the LovB MAT domain (AYLR681G) and may play a similar role in conferring substrate specifi- city towards malonyl-CoA and proofread against ace- tyl-CoA. Nevertheless, the poor activity of LovB MAT towards acetyl-CoA is indicative of a different initi- ation mechanism of polyketide biosynthesis in which the acetate starter unit may be derived from the decarboxylation of malonyl-CoA instead o f acetyl-ACP (see below). The broad ACP-specificity of the LovB MAT domain hints that the standalone protein may act as a general acyltransferase between malonyl-CoA and any holo-ACP domain. We assayed the ability of LovB MAT to substitute for scFabD in a type II PKS turn- over assay. The role of MAT in this assay is to gene- rate the malonyl-ACP extender unit in situ [36]. As shown in Fig. 5B, when the oxytetracycline minimal PKS was incubated with LovB MAT, the expected polyketide products, SEK15 and SEK15B, were syn- thesized. The decreased amounts of products reflect the slower turnover rate of LovB MAT is limiting the level of malonyl-OxyC available for polyketide biosyn- thesis (lane 2). Increasing the amount of LovB MAT in the reaction mixture led to an corresponding increase in the amount of product recovered (lane 3). These results confirm that the LovB MAT can indeed interact with heterologous PKS and reconstitute the activities of the type II minimal PKS, and strengthen the recent suggestion that iterative type I PKS can be considered as covalently linked type II PKS enzymes [23]. Biochemical characterization of the LovB KS-MAT (S656A) domain In order to isolate and study the property of the LovB KS domain, we constructed the LovB KS-MAT° S656A point mutant, which completely inactivates the MAT domain (Fig. 4C). The mutant was expressed and purified from BL21(DE3) ⁄ pSMA36 as described in the Experimental procedures section. The LovB KS-MAT° mutant was assayed for its specificity towards different acyl units. Acetyl-CoA has been proposed to be the starter unit for numerous fungal PKS and may acetylate the KS domain directly through a KS-mediated thioester exch ange. Alternatively, the PKS can generate a cetyl-KS through decarboxylation of malonyl-CoA or malonyl-ACP. No labeling of the KS-MAT° mutant by [ 14 C]malonyl-CoA and [ 14 C]acetyl-CoA can be observed (data not shown). To assay whether any of the acyl substrates are only activated by the KS domain transiently followed by 0 1 2 3 4 0 Concentration [ 14 C]acyl CoA (µ M ) fo revonruT 4 1 n im ( NO C - P C A - lyca C 1 – ) Malonyl Acetyl 123 SEK15/15b Baseline 250200 150100 50 A B Fig. 5. (A) Michaelis–Menten plot of the rate of acylation catalyzed by LovB MAT domain. LovB ACP-CON didomain was used as an acyl acceptor (50 l M). LovB MAT displayed a 20-fold improvement in kinetic properties (k cat ⁄ K m ) in transacylating malonyl-CoA (s) when compared to acetyl-CoA (e). (B) Radio-TLC analysis of poly- ketides produced by minimal oxy PKS (2 l M OxyA-OxyB (KS-CLF), LovB MAT or scFabD, 2 m M 14 C-malonyl-CoA (1.6 mCiÆmmol )1 ), 50 l M holo-OxyC), 25 °C, 30 min. Lane 1, 0.7 lM scFabD. The products were identified as SEK15 and SEK15b by comparison with standards; lane 2, 0.7 l M LovB MAT; lane 3, 7 lM LovB MAT. LovB MAT was able to support the turnover of oxy minimal PKS through the in situ generation of malonyl-OxyC. No products were detected in the presence of OxyA, OxyB and OxyC alone. Minimal polyketide synthase domains in LovB S. M. Ma and Y. Tang 2860 FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS interthiol acyltransfer to an ACP acceptor protein [37], we coincubated the KS-MAT° didomain with stand- alone ACP domains in the presence of the different acyl-CoAs. Surprisingly, we detected transfer of radio- labeled acyl unit to the ACP domains only in the pres- ence of [ 14 C]malonyl-CoA (Fig. 6). Addition of cerulenin to the reaction mixture significantly attenu- ated the rate of acyl transfer to ACP, validating that the detected thioester exchange is indeed facilitated by the active site cysteine of the KS domain [38]. The rate of label transfer by the KS domain is, however, signifi- cantly slower (k cat ⁄ K m < 0.05 min )1 Ælm )1 ) compared to that of the MAT domain, and hence unlikely to be a physiologically important mechanism of ACP malonylation during polyketide biosynthesis. However, our results clearly show that KS domain possesses interthiol acyltransferase activities and can distinguish between malonyl and acetyl-CoA. Furthermore, the KS domain also processes broad ACP specificity and is able to transfer the malonyl unit to the different ACP domains examined. Our results with the MAT and the KS-MAT° domains suggest that the fungal PKS may initiate polyketide synthesis through decarboxylation of malo- nyl-ACP as the predominant pathway. The KS domain does not display any detectable interthiol acyltransfer activity towards the acetyl unit in our assay; hence, it is unlikely to be directly primed by acetyl-CoA or acetyl-ACP. This is in contrast to the priming mechan- ism observed for both bacterial type I and type II PKS, where polyketide synthesis can be initiated by short chain alkylacyl-CoAs. The proposed priming mechanism for LovB KS-MAT° is consistent with our ongoing work with the bikaverin PKS (pks4) from Gibberella fujikuroi (S. M. Ma, J. Zhan & Y. Tang, unpublished data) and may represent a general mech- anism for the initial steps of fungal PKS biosynthesis. In conclusion, we have examined the minimal PKS components of the lovastatin nonaketide synthase by obtaining dissociated mono- and didomain proteins. We have shown that most of the domains examined can be expressed as standalone proteins, except the KS domain. We have shown that the LovB MAT displays strong substrate selectivity towards malonyl-CoA over acetyl-CoA and can functionally interact with bacterial PKS components in synthesizing a polyketide product, further strengthening the converging theory that iterat- ive type I PKS is a linear juxtaposition of bacterial PKS components. The LovB MAT displayed signifi- cantly different properties when compared to the mam- malian FAS MAT domain, especially in acyl-CoA substrate specificity. Our work with LovB also sets the stage for a more systematic exploration of the catalytic mechanisms of reduced fungal PKS, including the bio- chemical basis for iterative condensation and the logic of differential tailoring steps during each cycle of chain elongation. The broad specificity of the KS and MAT domains toward heterologous ACP domains may also provide immense opportunities for combinatorial bio- synthesis of novel polyketide entities. Experimental procedures Strains Genomic DNA from A. terreus strain ATCC 20542 was used as the template for PCR amplification. E. coli XL1- blue and E. coli BL21(DE3) were used as cloning and expression strains, respectively. For recombinant expres- sion of holo-ACPs in which the proteins are functionalized with the phosphopantetheine prosthetic group, the BAP1 strain [24], which contains a chromosomal copy of the B. subtilis phosphopantetheinyl transferase gene sfp, was used. Cloning of domains The lovB gene was amplified from A. terreus genomic DNA using splice by overlap extension PCR to delete the seven introns. Engineered restriction sites were introduced at putative domain boundaries via silent mutations to facili- tate domain cloning. The sites are KpnI (KS–AT bound- ary); XbaI (AT–dehydratase boundary) and SpeI (KR–ACP boundary). The boundaries were identified through multiple sequence alignment of LovB with individual modules from 6-DEBS, NSAS and rat FAS. The entire lovB gene was 12 34 5 6 KS-MAT 0 ACP-CON ACP cerulenin (200 µ M) -+ -+ -+ Fig. 6. LovB KS-MAT° mediated malonyl transfer from [ 14 C]malo- nyl-CoA to different ACP acceptors. Cerulenin is added to inhibit the KS functions. Lanes 1 and 2, LovB ACP-CON didomain; lanes 3 and 4, LovB ACP; lanes 5 and 6, DEBS M3 ACP; 50 m M NaH 2 PO 4 , pH ¼ 7.4, 3 l M KS-MAT°,2mM[ 14 C]malonyl-CoA, 10 lM ACP, 25 °C, 30 min. No transfer of [ 14 C]acetyl-CoA was observed. S. M. Ma and Y. Tang Minimal polyketide synthase domains in LovB FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS 2861 inserted into pET21a(+) between NdeI and EcoRI to create pSMa33, the expression plasmid for LovB with a C-ter- minal polyhistidine tag. The LovB KS-MAT didomain, MAT, ACP, ACP-CON and CON were each amplified from pSMa33 using the primer pairs shown in Table 1 and were cloned into pET28a(+) to yield the corresponding expression vectors. The KS-MAT didomain contained a C-terminal His-tag, whereas all the other constructs con- tained N-terminal His-tags. Design of the forward primer used to amplify t he recombinant MAT domain was facilitated through N-terminal sequencing of the truncated MAT domain, which was recovered from expression of the LovB KS-MAT didomain. The construction of DEBS M3 ACP [15], DEBS M6 ACP [15] and R1128 ZhuN [25] previously described. Site-directed mutagenesis Site-directed mutagenesis was used to generate the point mutants of the LovB MAT monodomain and KS-MAT didomain. The mutagenic primers are shown in Table 1. The expression plasmids pSMA73 and pSMa30 were used as the templates for MAT and KS-MAT mutagenesis, respectively. Restriction analysis of the plasmid products was first performed to identify mutants, followed by DNA sequencing of the entire gene to verify the intended mutations. Expression and purification of ACP proteins All ACP proteins (including ACP-CON) were expressed and purified using the following procedure. The expres- sion plasmids were transformed into E. coli BAP1 strain for holo-ACP expression and into E. coli BL21(DE3) strain for apo-ACP expression. The cells were grown at 37 °C in LB medium with 35 lgÆmL )1 kanamycin to an absorbance of 0.4 at 600 nm. The cells were incubated on ice for 10 min, and induced with 0.1 mm isopropyl thio-b-d-galactoside for 16–24 h at 16 °C. The cells were harvested by centrifugation (2500 g, Beckman Coulter Allegra X-12R, rotor SX4750, 10 min), resuspended in buffer A (20 mm Tris ⁄ HCl, 10 mm imidazole, 500 mm NaCl, pH ¼ 7.9), lysed by sonication, and cellular debris was removed by centrifugation (27 200 g, Beckman Coul- ter J2-21, rotor JA-20, 1 h). Ni-nitrilotriacetic agarose resin was added to the supernatant (3 mLÆ L )1 of culture) and the proteins were purified using affinity chromatogra- phy with increasing concentration of the imidazole in buffer A. Purified proteins were concentrated, and buffer exchanged into buffer B (50 mm Tris ⁄ HCl, pH ¼ 7.9, 2mm EDTA, 2 mm dithiothreitol, and 10% glycerol), ali- quoted and flash frozen. Protein concentrations were determined with the Bradford assay using BSA as a standard. Expression and purification of the LovB KS-MAT, LovB MAT, LovB MAT (S208A), LovB MAT (S209A) and LovB KS-MAT (S656A) The expression plasmids for each of the mono- and dido- mains were transformed into BL21(DE3). Cell growth, pro- tein expression and cell lysis were performed as described for the ACP proteins. Ni-nitrilotriacetic purification was used as a first chromatography step to purify all proteins. The MAT proteins were sufficiently pure (> 95%) after elution with buffer A + 250 mm imidazole. The MAT and mutants were then buffer exchanged into buffer B, ali- quoted and flash frozen. The KS-MAT didomains required a second purification step, largely due to a major contamin- ant protein subsequently identified as the truncated, MAT protein. After buffer exchange of the Ni-nitrilotriaceic puri- fied protein into buffer B, an anion-exchange chromatogra- phy was performed using a 5 mL HiTrap-Q column and a Biologic LP Chromatography system (Bio-Rad, Hercules, CA, USA). The following gradient was used with a flow rate of 2 mLÆmin )1 : buffer B, 8 CV; a linear gradient from buffer B to buffer C (buffer B + 1 m NaCl), 20 CV; buf- fer C: 8 CV. The truncated MAT and the intact KS-MAT eluted between approximately 200–250 mm NaCl with a majority of MAT eluted first as pure proteins. Pure MAT and KS-MAT fractions were separately collected, buffer exchanged into buffer B, aliquoted and flash frozen with liquid nitrogen. N-terminus Edman sequence analysis of MAT was performed at the Molecular Structure Facility at the University of California, Davis, CA, USA. Labeling of enzymes by [ 14 C]-malonyl- and [ 14 C]-acetyl-CoA Labeling of enzymes were performed in buffer L (100 mm NaH 2 PO 4 ,pH¼ 7.4, 2 mm dithiothreitol, 10% glycerol). Enzymes (1–10 lm) and radiolabeled acyl-CoA (180 lm, 55 mCiÆmmol )1 ) were added to buffer L (final volume 10 lL) and were incubated either at room temperature or on ice for 10 min. The reaction was quenched with one vol- ume of SDS ⁄ PAGE loading buffer lacking any reducing reagents such as dithiothreitol or b-mercaptoethanol. Sam- ples were directly loaded onto a 6% or 12% SDS ⁄ PAGE gel and electrophoresis was performed at 100 V for 90 min. The gel was dried and analyzed using a phosphoimager (Packard Instant Imager(tm), Packard Instrument Com- pany, Meriden, CT, USA). Transacylation activity of enzymes The transfer of acyl groups from acyl-CoA to acceptor ACPs was performed in buffer L. Holo-ACP domain was each added to a final concentration of 20–100 lm [ 14 C]-Malonyl- and [ 14 C]-Acetyl-CoA were added to a final Minimal polyketide synthase domains in LovB S. M. Ma and Y. Tang 2862 FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS concentration of 180 lm (55 mCiÆmmol )1 ). LovB MAT, LovB MAT (S208A), LovB KS-MAT and LovB KS-MAT (S656A) were added to initiate the reaction. The final con- centration of the enzymes was between 500 nm and 1 lm. The reaction was performed at room temperature for 30 min. Samples were quenched, separated on SDS ⁄ PAGE and the radiolabels were visualized by autoradiography. To perform the kinetic studies, the final acyl-CoA con- centrations were varied between 10 lm and 200 lm. The ACP-CON concentration was kept at 50 lm. In the mal- onylation reaction, LovB MAT and scFabD were added to final concentrations of 500 nm and 5 nm, respectively. In the acetylation reaction, both LovB MAT and scFabD were added to a final concentration of 1 lm. At each time point (1, 2 and 3 min), an aliquot of the labeling reaction (10 lL) was quenched with an equal volume of SDS ⁄ PAGE loading dye and kept on ice. The amount of acyltransfer was visualized by autoradiography as described above. Polyketide turnover assay The polyketide turnover assay was performed as described previously. The oxytetracycline minimal PKS, oxyA-oxyB (2 lm) and oxyC (50 lm), we re m ixed with 2 mm [1,2- 14 C] malonyl-CoA (1.6 mCiÆmmol )1 ) in buffer L (final volume 10 lL). The reaction was initiated by the addition of either scFabD (0.7 lm) or LovB MAT (0.7 lm or 2.7 lm). A neg- ative control without either scFabD or LovB MAT was also performed. After 30 min of incubation at 30 °C, the reaction mixture was extract twice by 300 lL ethyl acetate (EA). The combined EA phases were evaporated to dryness, redissolved in 10 lL of EA. The reaction products were separated by thin-layer chromatography (TLC) (EA ⁄ acetic acid, 99 : 1) and quantified with a phos- phoimager. Acknowledgements This work was supported by the American Heart Association (YT: 0535069N), the UCLA engineering school faculty start-up grant. We thank Chaitan Khosla for the expression plasmids for DEBS M3 and M6 ACPs. YT thanks Ms Alice Chen for helpful discussions. References 1 Tobert JA (2003) Lovastatin and beyond: the history of the HMG-CoA reductase inhibitors. Nat Rev Drug Discov 2, 517–526. 2 Kennedy J, Auclair K, Kendrew SG, Park C, Vederas JC & Hutchinson CR (1999) Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science 284, 1368–1372. 3 Hopwood DA & Sherman DH (1990) Molecular gene- tics of polyketides and its comparison to fatty acid bio- synthesis. Annu Rev Genet 24, 37–66. 4 Heath RJ & Rock CO (2002) The Claisen condensation in biology. Nat Prod Rep 19, 581–596. 5 Staunton J & Weissman KJ (2001) Polyketide biosyn- thesis: a millennium review. Nat Prod Rep 18, 380–416. 6 Hendrickson L, Davis CR, Roach C, Nguyen DK, Aldrich T, McAda PC & Reeves CD (1999) Lovastatin biosynthesis in Aspergillus terreus: characterization of blocked mutants, enzyme activities and a multifunc- tional polyketide synthase gene. Chem Biol 6, 429–439. 7 Donadio S, Staver MJ, McAlpine JB, Swanson SJ & Katz L (1991) Modular organization of genes required for complex polyketide biosynthesis. Science 252, 675–679. 8 Keller NP, Turner G & Bennett JW (2005) Fungal sec- ondary metabolism ) from biochemistry to genomics. Nat Rev Microbiol 3, 937–947. 9 Moriguchi T, Ebizuka Y & Fujii I (2006) Analysis of subunit interactions in the iterative type I polyketide synthase ATX from Aspergillus terreus. Chembiochem 7, 1869–1874. 10 Fujii I, Yoshida N, Shimomaki S, Oikawa H & Ebizuka Y (2005) An iterative type I polyketide synthase PKSN catalyzes synthesis of the decaketide alternapyrone with regio-specific octa-methylation. Chem Biol 12, 1301–1309. 11 Yu F, Zhu X & Du L (2005) Developing a genetic sys- tem for functional manipulations of FUM1, a poly- ketide synthase gene for the biosynthesis of fumonisins in Fusarium verticillioides. FEMS Microbiol Lett 248, 257–264. 12 Zhu X, Yu F, Li XC & Du L (2007) Production of dihydroisocoumarins in Fusarium verticillioides by swap- ping ketosynthase domain of the fungal iterative poly- ketide synthase Fum1p with that of lovastatin diketide synthase. J Am Chem Soc 129, 36–37. 13 Rangan VS & Smith S (1996) Expression in Escherichia coli and refolding of the malonyl- ⁄ acetyltransferase domain of the multifunctional animal fatty acid syn- thase. J Biol Chem 271, 31749–31755. 14 Tang Y, Kim CY, Mathews II, Cane DE & Khosla C (2006) The 2.7-Angstrom crystal structure of a 194-kDa homodimeric fragment of the 6-deoxyerythronolide B synthase. Proc Natl Acad Sci USA 103, 11124–11129. 15 Kim CY, Alekseyev VY, Chen AY, Tang Y, Cane DE & Khosla C (2004) Reconstituting modular activity from separated domains of 6-deoxyerythronolide B synthase. Biochemistry 43, 13892–13898. 16 Keatinge-Clay AT & Stroud RM (2006) The structure of a ketoreductase determines the organization of the beta-carbon processing enzymes of modular polyketide synthases. Structure 14 , 737–748. S. M. Ma and Y. Tang Minimal polyketide synthase domains in LovB FEBS Journal 274 (2007) 2854–2864 ª 2007 The Authors Journal compilation ª 2007 FEBS 2863 [...].. .Minimal polyketide synthase domains in LovB S M Ma and Y Tang 17 Chen AY, Schnarr NA, Kim CY, Cane DE & Khosla C (2006) Extender unit and acyl carrier protein specificity of ketosynthase domains of the 6-deoxyerythronolide B synthase J Am Chem Soc 128, 3067–3074 18 Tsai SC, Lu H, Cane DE, Khosla C & Stroud RM (2002) Insights into channel architecture and substrate... animal fatty acid synthetase Participation in the continuous exchange of acetyl and malonyl moieties between coenzyme a thioester and enzyme J Biol Chem 257, 799–803 35 Rangan VS & Smith S (1997) Alteration of the substrate specificity of the malonyl-CoA ⁄ acetyl-CoA:acyl carrier protein S-acyltransferase domain of the multifunctional fatty acid synthase by mutation of a single arginine residue J Biol... Gramajo H, Cane DE & Khosla C (2001) Biosynthesis of complex polyketides in a metabolically engineered strain of E coli Science 291, 1790–1792 25 Tang Y, Lee TS, Kobayashi S & Khosla C (2003) Ketosynthases in the initiation and elongation modules of aromatic polyketide synthases have orthogonal acyl carrier protein specificity Biochemistry 42, 6588–6595 26 Findlow SC, Winsor C, Simpson TJ, Crosby J & Crump... (2001) Crystal structure of the macrocycle-forming thioesterase domain of the erythromycin polyketide synthase: versatility from a unique substrate channel Proc Natl Acad Sci USA 98, 14808–14813 21 Udwary DW, Merski M & Townsend CA (2002) A method for prediction of the locations of linker regions within large multifunctional proteins, and application to a type I polyketide synthase J Mol Biol 323,... HE, Bari A & Smith S (1997) Characterization of the malonyl- ⁄ acetyltransacylase domain of the multifunctional animal fatty acid synthase by expression in Escherichia coli and refolding in vitro Protein Eng 10, 561–566 29 Witkowski A, Ghosal A, Joshi AK, Witkowska HE, Asturias FJ & Smith S (2004) Head-to-head coiled arrangement of the subunits of the animal fatty acid synthase Chem Biol 11, 1667–1676... B, Wessel WA & Hutchinson CR (1995) Malonyl-coenzyme A:acyl carrier protein acyltransferase of Streptomyces glaucescens: a possible link between fatty acid and polyketide biosynthesis Biochemistry 34, 9389–9402 37 Witkowski A, Joshi AK & Smith S (1997) Characterization of the interthiol acyltransferase reaction catalyzed by the beta-ketoacyl synthase domain of the animal fatty acid synthase Biochemistry... and dynamics of oxytetracycline polyketide synthase acyl carrier protein from Streptomyces rimosus Biochemistry 42, 8423–8433 27 Rangan VS, Witkowski A & Smith S (1991) Isolation of a functional transferase component from the rat fatty acid synthase by limited trypsinization of the subunit monomer Formation of a stable functional complex between transferase and acyl carrier protein domains J Biol Chem... Townsend CA (2006) Identification of a starter unit acyl-carrier protein transacylase domain in an iterative type I polyketide synthase Proc Natl Acad Sci USA 103, 16728–16733 23 Ma Y, Smith LH, Cox RJ, Beltran-Alvarez P, Arthur CJ & Simpson FRST (2006) Catalytic relationships between type I and type II iterative polyketide synthases: the Aspergillus parasiticus norsolorinic acid synthase Chembiochem 7, 1951–1958... 1667–1676 30 Maier T, Jenni S & Ban N (2006) Architecture of mammalian fatty acid synthase at 4.5 A resolution Science 311, 1258–1262 31 Mikkelsen J, Hojrup P, Rasmussen MM, Roepstorff P & Knudsen J (1985) Amino acid sequence around the active-site serine residue in the acyltransferase domain of goat mammary fatty acid synthetase Biochem J 227, 21–27 32 Keatinge-Clay AT, Shelat AA, Savage DF, Tsai SC, Miercke... specificity from crystal structures of two macrocycleforming thioesterases of modular polyketide synthases Biochemistry 41, 12598–12606 19 Giraldes JW, Akey DL, Kittendorf JD, Sherman DH, Smith JL & Fecik RA (2006) Structural and mechanistic insights into polyketide macrolactonization from polyketide- based affinity labels Nat Chem Biol 2, 531–536 20 Tsai SC, Miercke LJ, Krucinski J, Gokhale R, Chen JC, Foster . Biochemical characterization of the minimal polyketide synthase domains in the lovastatin nonaketide synthase LovB Suzanne M. Ma and Yi Tang Department of Chemical and Biomolecular Engineering,. 2007) doi:10.1111/j.1742-4658.2007.05818.x The biosynthesis of lovastatin in Aspergillus terreus requires two mega- synthases. The lovastatin nonaketide synthase, LovB, synthesizes the inter- mediate dihydromonacolin L using nine. 15-fold increase in the yield of the soluble protein. Pantetheinylation of the ACP in ACP- CON didomain was verified using MALDI-TOF of a tryptic fragment of the purified protein (data not shown). The