implementing a characterization of genre

... that every Q-algebra is in fact an operator algebra, results about operator algebras automatically apply to Q-algebras. And consequently, general results about the unit ball of an operator algebra ... Sarason which gives a representation of Pick algebras as singly generated algebras of operators on a Hilbert space. Sarason's theorem uses if 00 in place of A and an arbitrary ... [4] we studied a particular class of such norms which arise as follows: let A be a uniform algebra on a compact Hausdorff space X, with maximal ideal space Jt, and fix an H-tuple of points M l5

Ngày tải lên: 18/07/2014, 22:48

... Vietnam Journal of Mathematics 33:4 (2005) 369–379 A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces * Jingshi Xu Department of Mathematics, Hunan Normal University, Changsha, ... 6, 11, 16]. Many results obtained parallel with the theory of standard Besov and Triebel- Lizorkin spaces and new applications have also been given. Actually, in [7] Mazzuato established some ... (21) A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces 377 holds, where N  = N − a + n can be taken arbitrarily large. Similarly, we can prove that for all f ∈S  (R n ), ψ ∗ a

Ngày tải lên: 06/08/2014, 05:20

... episturmian sequences over an alphabet with 3 or more letters. We first study balanced standard episturmian sequences and from that characterization, as standard episturmian sequences have the same language ... ≥ 3. As a result, since episturmian sequences have the same language as stan- dard episturmian sequences, we prove a similar characterization for non-standard epis- turmian sequences. Finally, ... A ∞ = A ∗ ∪ A ω is the set of finite and right infinite words over A. A word w ∈ A ∞ is balanced if for all factors u and v of w having the same length, one has ||u| a − |v| a | ≤ 1 for every a

Ngày tải lên: 07/08/2014, 15:22

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 Torres AM, Tsampazi ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary

Ngày tải lên: 18/02/2014, 17:20

... for expression The gene was amplified with PCR from genomic Vibrio DNA using the primers 5¢-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and 5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3¢, cloned into ... each temperature), containing 100 mM NaCl, mM EDTA and 15 mM CaCl2, were heated and aliquots were withdrawn at intervals and immediately assayed for remaining activity against SucAAPF-NH-Np as ... on thermal stability and molecular adaptation of proteins, as well as potential candidates for biotechnological applications Several enzymes from psychrophilic bacteria have now been characterized

Ngày tải lên: 21/02/2014, 01:21

... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to )23, AAANNN TTATATA) ... (1990) Anaerobic lactate oxidation to 3 CO 2 by Archaeoglobus fulgidus via the carbon monoxide dehydrogenase pathway: demonstration of the acetyl- CoA carbon-carbon cleavage reaction in cell extracts. ... catalytic subunit of Hdr from methanogenic archaea have been deposited in the databases. None of these putative pro teins has b een c haracterized and no f unction has been assigned to any of

Ngày tải lên: 21/02/2014, 03:20

... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6 [32]. We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding ... CSP of M. brassicae is able to bind C12 to C18 alkyl chains. We therefore tested the capability of palmitic acid (C16-Ac) and a fluorescent anthroyloxy derivative fatty acid, ASA to affect ASP3c fluorescence.

Ngày tải lên: 21/02/2014, 03:20

... Annals of Mathematics Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold By Jean-Pierre Demailly and Mihai Paun Annals of Mathematics, 159 (2004), ... 00] and A. Lamari [Lam9 9a, 99b]; it turns out that there exists a very neat characterization of nef classes on arbitrary surfaces, K¨ahler or not. The Main Theorem has an important application ... 1247–1274 Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this work is to give a precise numerical description of the K¨ahler

Ngày tải lên: 05/03/2014, 23:20

... the Bradford assay using BSA as standard. Assay The decarboxylation activity of ScPPDC-His on a range of aromatic and aliphatic 2-keto acids was monitored at 30 °C by a coupled assay described ... Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae Malea M. Kneen 1 , Razvan Stan 1 , Alejandra Yep 2 , Ryan P. Tyler 2 , Choedchai ... Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res... Pyruvate decarboxylase: a

Ngày tải lên: 06/03/2014, 00:21

... Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J (2007) Identification and biochemical characterization of a novel carotenoid oxygenase: elucidation of the cleavage step in the Fusarium carotenoid ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... C, Mila I, Bouzayen M, Magallanes-Lundback M, DellaPenna D, McCarty DR & Klee HJ (2006) Characterization of three members of the Arabidopsis carotenoid cleavage dioxygenase family demonstrates

Ngày tải lên: 07/03/2014, 03:20

... (Ambion Inc., Austin, TX, USA) [pool number M-007643– 00, sequences CCAAGGAGATTGAAGAATT (1), GAT CATGCACTGAAATTTA (2), GATGAAACCTCTCAA ACTG (3), and CATCATCGCTGGACAATGT (4)], using FEBS Journal 274 ... Characterization of inhibitors of phosphodiesterase 1C on a human cellular system Torsten R Dunkern and Armin Hatzelmann Biochemistry Inflammation, ALTANA Pharma AG, Member of the Nycomed ... increase in intracellular Ca2+ concentrations (the mean values and standard deviations of three experiments are shown) (C) As measured by lactate dehydrogenase assays, treatment of A1 72 cells with

Ngày tải lên: 07/03/2014, 05:20

... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic ... amount of Bip-Pro in the extracellular uptake medium was quantified according to the laboratory standard HPLC (La-Chrom Ò ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and a ... Gly-Gln, Ala- Ala, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, Germany). Tert. butyloxycar- bonyl (Boc)–Bip,

Ngày tải lên: 07/03/2014, 05:20

... amoebiasis Dan Sato 1, *, Wataru Yamagata 2 , Shigeharu Harada 2 and Tomoyoshi Nozaki 1 1 Department of Parasitology, Gunma University Graduate School of Medicine, Japan 2 Department of Applied ... http://parasite.dept.med.gunma-u. ac.jp/Enozaki_lab.html *Present address Institute for Advanced Biosciences, Keio University, Tsuruoka, Yamagata, Japan Database Nucleotide sequence data are available in the DDBJ ⁄ EMBL ⁄ GenBank databases ... analog of Met, has been exploited as a therapeutic agent against cancer as well as against infections by protozoan organisms and periodontal bacteria. However, its mechanism of action remains poorly understood.

Ngày tải lên: 07/03/2014, 05:20

... 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢ ... 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime ... (Bio-Rad Laboratories, Hercules, CA 94547, USA) Primers specific for SmNR1 (forward: 5¢-AAAAACATCCCCCATTTCAGAA-3¢, reverse: 5¢-AACTACGCACATTCGGGTTGA-3¢) were designed by Primer Express Program TM (Applied

Ngày tải lên: 07/03/2014, 11:20

... cruzi (EAN90580), Euglena gracilis (AAQ19605), Isochrysis galbana (AAV33631), Pavlova lutheri (AAQ98793), Thraustochytrium sp. (AAN75710), Thalassiosira pseu- donana (AAX14506); D5 desaturases from ... polyunsaturated fatty acid (PUFA) biosynthesis. FAD, fatty acid desaturase; Elo, elongase; Elo5, D5 elongase; Elo6, D6 elongase; AA, arachidonic acid; EPA, eicosapentaenoic acid; DHA, docosahexaenoic ... a scan range of 20–500 Da. Retention times and mass spectra of peaks obtained were compared with those for standards (Sigma) or with those available on NBS75K (National Bureau of Standards database,

Ngày tải lên: 07/03/2014, 12:20

... extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank Accession No AY249052) ... CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella volvacea (Eur J Biochem 271) 323 Fig Alignment of deduced amino acid sequences of lac1 and other fungal laccases ... primordia (day 12), appearance of pinheads (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22), and mature fruiting body (day 23) The results of RT-PCR analysis of gene transcription

Ngày tải lên: 07/03/2014, 15:20

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP_2:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT

Ngày tải lên: 07/03/2014, 16:20

... was maintained by using beryllium metal foil to seal the X-ray optical path. Table 2. Summary of DSC data, suggested results, and additional characterizations sample no. peak onsets (°C) peak ... nitrogen purge. Evolved Gas Analysis. Simultaneous TG/MS and TG/gas chromatography (GC)/MS analysis were performed on several samples. A split was used to send a fraction of the evolved gases to a quadruple mass ... TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan. A nitrogen atmosphere was used for each trial. Some analyses were performed on a Perkin Elmer-7 TGA with an...

Ngày tải lên: 14/02/2014, 03:20

... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data is gratefully acknowl- edged. ... B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers ... depletion of a molar equivalent of dissolved O 2 . HPLC analysis of the products of the enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon...

Ngày tải lên: 18/02/2014, 06:20

... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal- ysis to amino acid-based chiral pharmaceuticals - exam- ples and perspectives. J Mol Catal B-Enzym 5, 1–11. 14 Liljeblad A & Kanerva LT...

Ngày tải lên: 18/02/2014, 08:20