... contained a truncated core OS and consisted of a linker (Glc-Kdo 2 )-lipid A structure. The phenotype of this mutant was examined to investigate the roles of different moieties of the LOS molecule ... those of the wild-type, indicating a truncated LOS molecule resulting from the mutant (Fig. 3A). Western blot analysis demonstrated that the LOS from O35Elgt3 l...
Ngày tải lên: 07/03/2014, 05:20
... PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5Â-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3Â and 5Â-GCGGCATGCT CA GTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3Â (His-tag underlined); PSAG with ... FEBS Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx
... Biochem. 270) Ó FEBS 2003 An arginyl in the N-terminus of the V 1a vasopressin receptor is part of the conformational switch controlling activation by agonist Stuart R. Hawtin 1, *, Victoria J. Wesley 1 , ... UK Defining how the agonist receptor interaction differs from that of the antagonist receptor and understanding the mechanisms of recep...
Ngày tải lên: 07/03/2014, 21:20
Economic Impact of the Abolition of the Milk Quota Regime – Regional Analysis of the Milk Production in the EU – doc
... (DG AGRI) within the project entitled " ;Economic Impact of the Abolition of the Milk Quota Regime – Regional Analysis of the Milk Production in the EU& quot; (AGRI-2007-0444). The project ... the milk quota regime with the accession in the EU: – In the EU- 15 quota rents vary from 2-4% in Finland, Sweden and the UK...
Ngày tải lên: 18/03/2014, 00:20
Đề tài " A quantitative version of the idempotent theorem in harmonic analysis " docx
... 1025–1054 A quantitative version of the idempotent theorem in harmonic analysis By Ben Green* and Tom Sanders Abstract Suppose that G is a locally compact abelian group, and write M(G) for the algebra ... Balog-Szemer´edi-Gowers-Freiman). Let A be a subset of an abelian group G, and suppose that there are at least δ |A| 3 additive quadruples (a 1 , a 2 , a...
Ngày tải lên: 22/03/2014, 20:21
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAA...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Phosphorylation of the arginine/serine dipeptide-rich motif of the severe acute respiratory syndrome coronavirus nucleocapsid protein modulates its multimerization, translation inhibitory activity and cellular localization pptx
... 4157 Phosphorylation of the arginine/serine dipeptide-rich motif of the severe acute respiratory syndrome coronavirus nucleocapsid protein modulates its multimerization, translation inhibitory activity ... translation inhibitory activity and subcellular localization. Results Phosphorylation of the RS-rich motif of the SARS-CoV N...
Ngày tải lên: 23/03/2014, 07:20
Research " A DISSERTATION SUBMITTED TO THE GRADUATE FACULTY in partial fulfillment of the requiriments for the degree of DOCTOR OF PHILOSOPHY " doc
... h 9" alt =""
Ngày tải lên: 30/03/2014, 01:20
báo cáo sinh học:" Intent to migrate among nursing students in Uganda: Measures of the brain drain in the next generation of health professionals" pot
... conditions in Uganda and abroad were comparable. Intent to migrate We found 70 percent of nursing students expressed an intent to migrate out of Uganda. The percentage of nurs- ing students desiring to ... groups of students intending to emigrate to the U.K. or U.S. were of having a positive outlook of working conditions abroad, including finding a...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Wrong schools or wrong students? The potential role of medical education in regional imbalances of the health workforce in the United Republic of Tanzania" potx
... Kolstad: Wrong schools or wrong students? The potential role of medical education in regional imbalances of the health workforce in the United Republic of Tanzania. Human Resources for Health 2010 ... 8:3 http://www.human-resources -health. com/content/8/1/3 Page 11 of 11 RESEARC H Open Access Wrong schools or wrong students? The...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học:" Validation of the Spanish version of the Chronic Pain Acceptance Questionnaire (CPAQ) for the assessment of acceptance in fibromyalgia" pot
... Luciano 5 Abstract Background: The aim of this study was to validate a Spanish version of the Chronic Pain Acceptance Questionnaire (CPAQ). Pain acceptance is the process of giving up the struggle with pain and learning ... provided the original work is properly cited. Research Validation of the Spanish version of the Chronic Pain Accept...
Ngày tải lên: 20/06/2014, 16:20
báo cáo khoa học:" Performance and cross-cultural comparison of the short-form version of the CPQ11-14 in New Zealand, Brunei and Brazil" pps
... article as: Foster Page et al.: Performance and cross-cultural comparison of the short-form version of the CPQ 11-14 in New Zealand, Brunei and Brazil. Health and Quality of Life Outcom es 2011 9:40. Submit ... generalisability of the findings is limited. On the other hand, the relative uniformity o f findings in convenience samples from a number o...
Ngày tải lên: 12/08/2014, 01:22
a translation quality assessment of the vietnamese version of the nover the notebook by petal lê (2010) using peter newmark's model = đánh giá chất lượng bản dịch tiếng việt của tiểu thuyết nhật ký (2010) do petal lê
... VIETNAMESE VERSION OF THE NOVEL THE NOTEBOOK BY PETAL LÊ (2010) USING PETER NEWMARK’S MODEL (Đánh giá chất lượng bản dịch tiếng Việt c a tiểu thuyết Nhật ký (2010) do Petal Lê dịch theo ... the translation quality assessment of the Vietnamese version of the novel The Notebook translated by Petal L...
Ngày tải lên: 02/03/2015, 14:21
Đánh giá chất lượng bản dịch Tiếng Việt tác phẩm “Chicken Soup for Mother and Daughter Soul” áp dụng mô hình của Julliane House= evaluating the vietnamese version of the book chicken soup for mother and daughter soul by jack candfield and mark victor has
... SOUL BY JACK CANDFIELD AND MARK VICTOR HASEN USING JULLIANE HOUSE’S MODEL (Đánh giá chất lượng bản dịch Tiếng Việt tác phẩm Chicken Soup for Mother and Daughter Soul áp dụng mô hình của ... HASEN USING JULLIANE HOUSE’S MODEL (Đánh giá chất lượng bản dịch Tiếng Việt tác phẩm Chicken Soup for Mother...
Ngày tải lên: 02/03/2015, 14:32
THE TRANSLATION PROCEDURES IN VIETNAMESE VERSION OF THE BOOK BIOLOGY BY CAMPELL, N.A. AND REECE
... also the teachers and students of Biology and the teachers of English who will assist their colleagues in their teaching and learning Biology in English in the future. 2. Aims of the study The ... Exploring the translation procedures proposed by Newmark applied in translating the book Biology by Campbell into Vietnamese. Evaluating these...
Ngày tải lên: 14/07/2015, 11:53