A biophysical elucidation for less toxicity of Agglutinin than Abrin-a from the Seeds of Abrus Precatorius in consequence of crystal structure pot

... 1. Table 1: Crystal data and refinement statistics for AAG. Crystal ID AAG Agglutinin A- Chain Residues 1-250 Agglutinin B-Chain Residues 5-267 Agglutinin C-Chain Residues 1-250 Agglutinin D-Chain Residues ... Bagaria A, Surendranath K, Ramagopal UA, Ramakumar S, Karande AA: Structure- Function Analysis and Insights into the Reduced Toxicity of Abrus precatorius Ag...

Ngày tải lên: 10/08/2014, 05:21

... a ecting my heart, brain, or legs. *If you’re an African American, Hispanic, American Indian/Alaska Native, Asian American, or Pacific Islander woman, you’re more than twice as likely as a ... higher For women, a waist size of more than 35 inches also increases heart disease risk. is is because fat located in the abdo- men increases atherosclerosis more than fat loca...

Ngày tải lên: 14/03/2014, 12:20

... 5¢-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse). The pET151 HP1287 plasmid was ... Software Inc., San Diego, CA, USA), evaluating the initial rates by using the absorbance values at a fixed time in the linear segment of the regis- tered curves. To determine...

Ngày tải lên: 16/03/2014, 00:20

... constants t g and p g also appear. In 1993, the author [18] showed that many natural families of maps satisfy asymptotic formulas similar to (1) in which the same constants t g and p g appear in the coefficients. So ... of a variety of maps on surfaces and the parameters t g (r) and p g (r) arise in the corresponding bivariate asymp- totics for maps as well as embedd...

Ngày tải lên: 08/08/2014, 12:23

... lie behind them, a far away glance into the Eternal, an apotheosis of the most trifling and transitory things. Goethe, the grand heathen, knew the sweet peace which comes from Heaven; and when ... said I; "therein lies the cause of many hot and bitter struggles; that the teachings of Christ, instead of winning our hearts gradually and irresistibly, as they won...

Ngày tải lên: 06/03/2014, 08:20

... Tempera painting in the Akbar Namahby Abu'l Fazl. Photographed from the original in the India Museum for The Place of Animals in Human Thought by the Countess Evelyn Martinengo Cesaresco. ... the whole of Hindustan including the peninsula Gujerat, the lands of the Indus and Kashmir but also Afghanistan and a larger part of the Dekkhan than h...

Ngày tải lên: 06/03/2014, 12:20

... designed against methionine gamma- lyase-containing pathogens, has efficacy in vitro and in vivo against Trichomonas vaginalis. Antimicrob Agents Chemother 45 , 1743–1745. 27 Inoue H, Inagaki K, Adachi ... parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14]. MGL has been implicated in the degradation of toxic...

Ngày tải lên: 07/03/2014, 05:20

... [38], that the C-terminal tail of the S cTXs are playing an important role in the biological activity of these toxins, and should constitute an important point of diversification of the interacting ... but they show vast differences in p reference f or insect and mammalian Na + channels. Accordingly, they are divided into classical a- toxins that are highly active in mam...

Ngày tải lên: 07/03/2014, 16:20

... or obtain, and continuously maintain, financial assurance that is adequate to assure the Department that the owner or operator is at all times financially capable of complying with the provisions of 314 ... volumes and schedule for the activity; c. a physical and chemical characterization of the material and the soil at the receiving location within and adjacent to th...

Ngày tải lên: 15/03/2014, 16:20