... in 252 Proceedings of the 48th Annual Meeting of the Association for Computational Linguistics, pages 247–256, Uppsala, Sweden, 11 -16 July 2 010 . c 2 010 Association for Computational Linguistics A Bayesian Method ... Shaul Marcus, and Shaul Markovitch. 19 95. Contextual word similarity and estimation from sparse data. Computer, Speech and Language, 9 :12 3 15 2. Ido Dagan, Lillian Lee, and Fernando Pereira. 19 97. Similarity-based ... that are actually evaluated, with about 11 5 answers on average, and “B” contained 3,657 words with about 65 answers on average. Set “C” contained 8,853 words with about 1, 700 answers on average. 5.4...
Ngày tải lên: 30/03/2014, 21:20
... the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity de- pending on the material preparation and annealing atmosphere (Fig. 12 ). Titania nanotubes prepared ... mag- netically stirred, anodized titanium samples are designated in the main text as UAT and SAT, respectively. 2.3. Annealing of the materials The anodized titania nanotubular arrays were annealed ... H 3 PO 4 and 0 .14 M NaF solution at 20 V for 12 00 s and annealed under H 2 at 500 ◦ C. S.K. Mohapatra et al. / Journal of Catalysis 246 (2007) 362–369 363 Fig. 1. Experimental setup for anodization of...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... The peaks at 16 32 and 14 93 cm -1 are assigned to CO2 absorbed on the surface of nanoparticles. The peaks at 13 50 and 898 cm -1 are assigned to C-H and C-C bonding vibrations of organic impure ... There are several methods for the synthesis of nanoscale CaO, including sol-gel[ 21] , gas phase condensation[ 21] , laser ablation[ 21] , ame processing[22], sonochemical, microwave plasma[23], ... Chemical Research www.jacr.kiau.ac.ir A Novel Method for the Synthesis of CaO Nanoparticle for the Decomposition of Sulfurous Pollutant Meysam Sadeghi *1 , Mir Hassan Husseini 2 1, 2 Department...
Ngày tải lên: 06/05/2014, 08:55
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... data analysis and the preparation of the manuscript. MJS supervised the study plan- ning, data analysis and preparation of the manuscript. All authors read and approved the final manuscript. Acknowledgements The ... Correspondence: martin.stoddart@aofoundation.org 1 AO Research Institute, Clavadelerstrasse 8, 7270 Davos, Switzerland Full list of author information is available at the end of the article Jähn et al. Journal ... Volker Braunstein 3 , Pamela I Furlong 1 , Angharad E Simpson 1 , R Geoff Richards 1, 2 and Martin J Stoddart* 1 Abstract Background: Bone graft studies lack standardized controls. We aim to present...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo toán học: "A construction method for complete sets of mutually orthogonal frequency squares" pdf
Ngày tải lên: 07/08/2014, 06:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... the maintenance of intracellular heme level Yongzhao Zhang 1 , Kazumichi Furuyama 1 , Kiriko Kaneko 1 , Yuanying Ding 1 , Kazuhiro Ogawa 2, *, Miki Yoshizawa 1 , Masaki Kawamura 1 , Kazuhisa Takeda 1 , ... 12 1, 11 62 11 68. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase -1 by hypoxia in vascular endothelial ... hypoxia and free radicals in human dermal fibroblasts. Am J Physiol Cell Physiol 278, C92–C1 01. 16 Udono-Fujimori R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học:" Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1?" pdf
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1" pdf
Ngày tải lên: 12/08/2014, 04:21
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... that begins at Asp1 and terminates at Val40 (Fig. 1) [2– 11 ]. Increased production of Ab1–42, a peptide that differs from Ab1–40 by addition of Ile and Ala to Keywords A ; Alzheimer’s disease; aggregation; amyloid;...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for ... Oreda B et al. (2003) The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility. J Cell Biol 16 2, 11 11 11 22. 8 ... 250 kDa 15 0 kDa 10 0 kDa 10 0 kDa 75 kDa 50 kDa 10 0 kDa 75 kDa Lyve -1 Prox -1 VEGFR-3 tsA58 T Ag / tublin Lyve -1 DaAPI DaAPI Lyve -1 Prox -1 CDa 31 DaAPI Magnetic A B C D E immunosorting...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... Annual Meeting of the Association for Computational Linguistics, pages 18 8 -19 5. Ferreira da Silva, J. and G. Pereira Lopes (19 99). A local maxima method and a fair dispersion normalization for ... Tsujii. 19 92. Automatic Learning for Semantic Collocation. Proceedings of the 3rd Conference on Applied Natural Language Processing, pages 10 4- 11 0. Shimohata, S., T. Sugio, and J. Nagata. (19 97). ... 605– 613 , Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms Paul Deane Center for Assessment, Design and...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot
... Lincoln, and Roger Nasr. 19 89. Efficient implementation of lat- tice operations. ACM Transactions on Programming Languages and Systems, 11 (1) :11 5 14 6, January. 15 20 Module n b 0 λ b λ mrs_min 10 7 ... 7 conj 13 8 1 7 list 27 15 1 11 local_min 27 21 1 10 cat_min 30 17 1 14 individual 33 15 0 15 head_min 247 55 0 55 * sort * 247 12 9 3 10 7 synsem_min 612 255 0 255 sign_min 10 25 489 3 357 mod_relation ... ERG contain thou- sands of types. We use binary constraints be- tween every pair of types, for a total of millions of constraints—and these are variables and con- straints over a domain of sets,...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... increased value of k ATPase as compared to the value k 0 ATPase ¼ 1: 6h 1 . At values of k ATPase exceeding seven-fold of its normal value, no stationary states can be found; that is, k max ATPase ¼ ... LL variant. Except for the PL variant, all other variants of approximate models failed in some test cases to provide stationary solutions for all parameter variations. Calculation of stationary ... investigation of the salvage metabolism, we anticipated a typical situation when only a minimal amount of data is available. The SKM method requires data on metabolite concentrations and fluxes for...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot
... and future approaches. In Proceedings of the First Conference of the Association for Machine Translation in the Ameri- cas, pages 19 3–205, Columbia, Maryland. BLEU: a Method for Automatic Evaluation ... evaluation. We propose such an evalua- tion method in this paper. 1. 2 Viewpoint How does one measure translation performance? The closer a machine translation is to a professional human translation, ... a method of automatic ma- chine translation evaluation that is quick, inexpensive, and language-independent, that correlates highly with human evalu- ation, and that has little marginal cost per run....
Ngày tải lên: 23/03/2014, 20:20
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... 2,200 Haiti 8,550 8,839 9,207 Honduras 3 ,14 2 3 ,14 3 3,377 India 12 ,600 14 ,222 12 ,852 Indonesia 11 ,400 13 ,800 14 ,15 7 Jamaica 544 539 497 Kenya 1, 000 1, 000 989 Liberia 1, 200 1, 200 1, 582 Madagascar 2,825 ... region. For example, the Bureau for Africa reported that these grants comprised about one-fifth of USAID’s total allocations for child survival across sub-Saharan Africa. USAID officials told ... government of Senegal’s Ministry of Health, a local university, and a major pharmaceutical company to introduce and evaluate su ch an approach. The bureau also provided technical assistance to...
Ngày tải lên: 28/03/2014, 09:20
Bạn có muốn tìm thêm với từ khóa: