Ngày tải lên: 20/06/2014, 04:20
... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared in the buffer supplied with ... enzyme, and contained Aba, Abb and Abcat 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP. The product was separated from...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde;...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article A Computationally Efficient Method for Polyphonic Pitch Estimation" pdf
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên: 23/06/2014, 01:20
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf
Ngày tải lên: 28/06/2014, 22:20
Tài liệu Building a Cisco Network for Windows 2000 P1 pdf
... my grandfather, Arthur Conat, drove a carriage with horses when he was a teenager. He didn’t have a TV, or a telephone, or a car, or a refrigerator, or a washing machine, or running water aside ... International for making certain that our vision remains worldwide in scope. Annabel Dent, Anneka Baeten, Clare MacKenzie, and Laurie Giles of Harcourt Australia for all their help. David Buckland, Wendi ... Ellen Lafferty and Sarah MacLachlan of Publishers Group West for sharing their incredible marketing experience and expertise. Mary Ging, Caroline Hird, and Simon Beale of Harcourt International for making...
Ngày tải lên: 23/12/2013, 01:16
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf
... participants found TransAhead suggestions satisfying, accepted, and learned from them; c) interactivity made translation and language learning more fun and the participants found TransAhead ... Ortiz-Martinez, L. A. Leiva, V. Alabau, I. Garcia-Varea, and F. Casacuberta. 2011. An interactive machine translation system with online learning. In Proceedings of ACL System Demonstrations, pages ... European Chapter of the Association for Computational Linguistics, pages 16–19, Avignon, France, April 23 - 27 2012. c 2012 Association for Computational Linguistics TransAhead: A Writing Assistant...
Ngày tải lên: 22/02/2014, 03:20
Tài liệu A Science Roadmap for Food and Agriculture pdf
... economic data are needed to provide more accurate estimates of climate change impacts, the potential costs and benets of adaptation, and to validate and calibrate models. • Quantify costs and ... of adaptation at the farm level and for specialty crops and livestock as well as grain crop production systems. • Assess economic impacts and costs of adaptation beyond the farm gate for ... given that regional variations in soils and climate are large and that there are a number of potential bioenergy crops, along with algae, that can be considered. This complexity mandates an integrated...
Ngày tải lên: 22/02/2014, 05:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair dispersion normalization for ... 605–613, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms Paul Deane Center for Assessment, Design and Scoring ... lexical association measures on unfiltered data no doubt has multiple explanations, but a logical candidate is the failure or inappropriacy of underlying statistical assumptions. For instance,...
Ngày tải lên: 08/03/2014, 04:22
Target Score Teacher''''s Book: A Communicative Course for TOEIC® Test Preparation pdf
...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... The load charac- teristics were calculated by varying a load parameter within a preset range of physiologically reasonable values. For each value of the load parameter, the steady state was computed ... increased value of k ATPase as compared to the value k 0 ATPase ¼ 1:6h À1 . At values of k ATPase exceeding seven-fold of its normal value, no stationary states can be found; that is, k max ATPase ¼ ... physiologically feasible ranges: 1 2 k 0 ATPase k ATPase 2k 0 ATPase (small variation of the energetic load) 1 5 k 0 ATPase k ATPase 5k 0 ATPase (large variation of the energetic load) 1 50 k 0 ox ...
Ngày tải lên: 23/03/2014, 06:20
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... reports, and program reports, such as the Bureau for Africa’s Child Survival in Sub-Saharan Africa – Taking Stock. We assessed the reliability of financial data compiled and generated by USAID’s ... allocations for child survival across sub-Saharan Africa. USAID officials told us that grantees may pilot innovations (see sidebar) or work in a country’s most rural and hard-to-reach areas. Also, ... the CS/MH account, USAID allocated funds for maternal and child health efforts in 40 countries, in Latin America, sub-Saharan Africa, and South Asia. Figure 2 illustrates the global distribution...
Ngày tải lên: 28/03/2014, 09:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Estimation of Distributional Similarities Jun’ichi Kazama Stijn De Saeger Kow Kuroda Masaki Murata † Kentaro Torisawa Language Infrastructure Group, MASTAR Project National Institute of Information ... of ACL 94. Ido Dagan, Shaul Marcus, and Shaul Markovitch. 1995. Contextual word similarity and estimation from sparse data. Computer, Speech and Language, 9 :123 152. Ido Dagan, Lillian Lee, and ... pro- files are multinomial distributions, the pri- ors are Dirichlet, and the base measure is the Bhattacharyya coefficient, we can de- rive an analytical form that allows efficient calculation. For the...
Ngày tải lên: 30/03/2014, 21:20
Bạn có muốn tìm thêm với từ khóa: