... sum of paths through reaction-centered graphs of the type of Graph (these paths may contain parallel and antiparallel arrows) The sign of that element therefore depends on the both the sign and ... autoinfluence paths occur in that subnetwork We shall speak of a negative subgraph in this case We define the value of a subgraph that contains p reactions and p concentrations, as minus the sum of all its ... degradation (–ajsajs) and a second influence through its autocatalytic feedback (+ajsbjs) through the same reaction, vs The latter influences cancel each other, again as all stoichiometries are...
Ngày tải lên: 19/02/2014, 16:20
... comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming nutrition and physical activity into all relevant policies at local, ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... determinants of diet and physical activity Certain neighbourhoods could discourage physical activity, lack recreation facilities and affect the disadvantaged more than those who can afford or have access...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... is a collection of i.i.d mean A Poisson variables plus a finite number of particles which started at time zero at fixed locations (these are the particles added as B-particles at the start) For ... random-walk paths associated to the various particles and (1) (2) assume that the Markov processes {Yt } and {Yt } are constructed by means of the same set of paths A (·, ρ) starting with state ... right-hand side here for k ≥ The basic inequalities remain valid for k = by trivial modifications which we again leave to the reader For the various estimates we have to take all tk large This will automatically...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere Distribution of bacteria As bacteria possess greater powers of resistance ... liquefying at surface; c, a rapid liquefying form; d, a gas-producing form that grows equally well in lower part of tube as at surface (facultative anaerobe); e, an obligate anaerobe, that develops ... cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable to such a...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic ... superior at achieving the manager's goals of obtaining appropriate-ate behavior from a variety of targets The first three propositions consider MOA separately Motivation is goal-directed arousal (Maclnnis,...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S ... Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic activity YN-1, K562, HeLa...
Ngày tải lên: 19/02/2014, 06:20
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers pot
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... United States of America National Academy of Sciences National Academy of Engineering Institute of Medicine National Research Council The National Academy of Sciences is a private, nonprofit, self-perpetuating ... Project Assistant SUZANNE OSSA, Senior Project Assistant DAVID DRAKE, Project Assistant DAVID PADGHAM, Research Assistant BRANDYE WILLIAMS, Office Assistant vi Preface C ontinued advances in information...
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating ... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes...
Ngày tải lên: 07/03/2014, 12:20
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc
... constraints and creating a system that functions properly for the application domain while remaining understandable and manageable by human operators, users, and—in many cases—casual passersby, ... the relatively constrained capabilities of individual elements Adaptive coordination is a fairly new area of investigation, particularly as it applies to EmNets To obtain necessary adaptability ... from solar panels The limited amount of raw power available will have a substantial effect on all aspects of EmNets, from the amount of computation that can be performed on a local physical sensing...
Ngày tải lên: 15/03/2014, 15:20
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc
... online application obtains the measures for all the metrics and levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided ... with a brief summary of the informa- 140 The Metric-dependent Information A SIYA operates over a fixed set of translation test cases, i.e., a source text, a set of candidate translations and a set ... type of information used by each family of measures according to their classification, and how this information can be used for MT error analysis purposes Lexical information There are several variants...
Ngày tải lên: 16/03/2014, 20:20
Báo cáo khoa học: "A Graphical Tool for GermaNet Development" ppt
... displayed It is possible to edit the examples and frames associated with a lexical unit via the Examples and Frames tab Frames specify the syntactic valence of a lexical unit Each frame can have an ... plan to adapt the tool so that it can be used with wordnets for other languages as well This would mean that the wordnet data for a given language would have to be stored in a relational database ... can have an associated example that indicates a possible usage of the lexical unit for that particular frame The tab Examples and Frames is thus particularly geared towards the editing of verb entries...
Ngày tải lên: 17/03/2014, 00:20
The Help! Kit - A Resource Guide for Secondary Teachers of Migrant English Language Learners
... federal and state legislative initiatives and various national, state, and local organizations, all of which involve the effort to make English the official language of the U.S The initiatives and ... in a classroom that is usually comprised of half native English speakers and half native speakers of the other language (Christian, D., 1994) CALP—Cognitive academic language proficiency; a mastery ... Home-School Partnerships,” for more in-depth information.) The family is essentially patriarchal, at least to outward appearances The roles of males and females are clearly defined—males are seen as the...
Ngày tải lên: 17/03/2014, 17:46
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of §2 is translated ... syntactic coverage of English grammars In DARPA, editor Proceedings of the Fourth Darpa Speech and Natural Language Workshop, pages 306-311, Pacific Grove, California, February, Morgan Kaufmann ... divergent parses.' Last of all, the XML format into which we translate the parses is an open exchange format It is an important asset for portability and reuse of parsing technolgy E.g for question answering...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo "A new formulation for fast calculation of far field force in molecular dynamics simulations " ppt
... force calculation – a significant calculation part of FMM on GRAPE Remaining parts of the paper are organized as follows In section we gives a summary of the FMM and related algorithms as well as ... Computational Physics 87 (1990) 161 [9] T Amisaki, S Toyoda, H Miyagawa, K Kitamura, Development of hardware accelerator for molecular dynamics simulations: a computation board that calculates nonbonded ... expansion P2 M2 M2L M2L conversion evaluation of formula pseudoparticle potential L2L local expansion Anderson’s method Near field force evaluation of physical-particle force Far field force evaluation...
Ngày tải lên: 22/03/2014, 11:20
Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc
... of Banks, Financial Institutions and Corporates worldwide Some of our clients: ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and ... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... the Middle East ■ Bank Pekao SA ■ Bank Zachodni WBK SA ■ BBVA Group ■ BNP Paribas ■ Calyon ■ Central Bank of Kuwait ■ Caixa Geral de Depositos ■ China International Capital Corporation ■ Citigroup...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... c attached These recombinant proteins were used for preparation of the antibodies against red algal PsbQ¢, PsbV and PsbU, cyanobacterial PsbU and green algal PsbQ The antibodies against spinach ... Structure of the thylakoid and envelope membranes of the cyanelles of Cyanophora paradoxa Plant Physiol 71, 409–419 21 Shibata M, Kashino Y, Satoh K & Koike H (2001) Isolation and characterization of...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo "A GRAPHICAL EDITOR FOR THE STATECHARTS LANGUAGE " doc
... developing software components based on Statecharts (state machines) Some key features of Anystates are: state of the–art graphical Statechart editor, synchronous graphical and textual views on a Statechart, ... users can draw large diagrams with the hierarchical feature of Statechart_E Users can export the edited Statecharts to some graphical formats for portability and for documentation Users can also ... contact information A graphical edior for the statecharts language 3.3 The hierarchical feature Statechart_E is built to construct the hierarchical Statecharts It means that users can easily...
Ngày tải lên: 28/03/2014, 13:20
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... observed values of various wave characteristics, it can be remarked that the numerical model can simulate wave transformation in the nearshore region with an acceptable accuracy. ... the coastal structures. Zero gradients of k and ε are assumed at the offshore, lateral boundaries and at surfaces of coastal structures. A scheme similar to that of Hibberd and Peregrine ... Fig. 1. The bed elevations at cell corners (such as points A, B, C and D in Fig. 1) are evaluated as the average value of the bed elevation at four adjacent points. For example, the bed elevation at point C in this figure is evaluated ...
Ngày tải lên: 28/03/2014, 15:20