Tiểu luận:Cây sinh dòng virus lở mồm long móng serotybe A ppt

... GS/LX/62; AJ131663, AJ131664, AJ131665, AJ131666), A2 2/Iraq 24/64 , Albania/1996 (Albania/96), Iran/1987, SaudiArabia/1992 (SAU/92) ,A2 2/Thailand/1993 (Thailand/93), Thailand/1996 (Thailand/96), ... A2 2/550 Azerbaijan/65 (A2 2/Azerbaijan/65; X74812), A2 4/Cruzeiro/Brazil/55 (A2 4/Brazil/55; K03340), A2 7/Cundinmarca/Colombia/76 (A2 7/Colombia/76; K03341), Argentina/79 (K03345), 81/...

Ngày tải lên: 22/03/2014, 12:20

... GS/LX/62; AJ131663, AJ131664, AJ131665, AJ131666), A2 2/Iraq 24/64 , Albania/1996 (Albania/96), Iran/1987, SaudiArabia/1992 (SAU/92) ,A2 2/Thailand/1993 (Thailand/93), Thailand/1996 (Thailand/96), ... A2 2/550 Azerbaijan/65 (A2 2/Azerbaijan/65; X74812), A2 4/Cruzeiro/Brazil/55 (A2 4/Brazil/55; K03340), A2 7/Cundinmarca/Colombia/76 (A2 7/Colombia/76; K03341), Argentina/79 (K03345), 81/...

Ngày tải lên: 22/02/2014, 19:28

... SA, Jamieson DJ, Bresee JS. Pandemic influenza and pregnant women. Emerg Infect Dis 2008;14:95 100. 7. Capua I, Alexander DJ. Human health implications of avian influenza viruses and paramyxoviruses. ... Vennema H, et al. Transmission of H7N7 avian influenza A virus to human beings during a large outbreak in commercial poultry farms in the Netherlands. Lancet. 2004; 363: 587–593....

Ngày tải lên: 13/02/2014, 11:20

... foot and mouth disease virus carrier and subclinically infected animals and differentiation from vaccinated animals” 11. Jian-Zhong YI1, Ming-Qiu LIU1, Cai-Zhu ZHU2, Qiang ZHANG1, Zu-Tian SHENG3, ... THAM KHẢO 1. Martinez-Salas E, Saiz M, Sobrino F (2008). " Foot-and-Mouth Disease Virus ". Animal Viruses: Molecular Biology . "Foot-and-Mouth Disease virus& quot; . Cai...

Ngày tải lên: 28/03/2014, 15:20

... http://vi.wikipedia.org/wiki/L%E1%BB%9F_m%E1%BB%93m _long_ m%C3%B3ng 9. http://www.anova.com.vn/contents/article.asp?id=265&detail=16&ucat=42 10. DANIEL SA-CARVALHO, ELIZABETH RIEDER, BARRY BAXT,1 RENATO RODARTE, AMILCAR TANURI, AND ... W. MASON. Tissue Culture Adaptation of Foot-and-Mouth Disease Virus Selects Viruses That Bind to Heparin and Are Attenuated in Cattle. Plum Isl...

Ngày tải lên: 05/03/2014, 16:20

... V. Virus LMLM Virus sốt lở mồm long móng (Foot and mouth disease virus) 1. Hình thái Virus LMLM thuộc loại virus nhỏ nhất trong các virus qua lọc, thuộc họ Picornaviridae, chi Aphthovirus. ... dịch lở mồm long móng Virus lở mồm long móng Gia súc mẫn cảm bệnh lở mồm long món g Kiểm soát vận chuyển qua biên giới quốc gia và vùng thiếu...

Ngày tải lên: 13/02/2014, 11:20

... ph a Nam Tandania, Malauy, Zaia và Angola đều có dịch LMLM. Không có bệnh ở Mađagatca và động vật nuôi phổ biến ở Zimbabuê, Bốtxoana, Namibia và cộng hoà Nam Phi nhng bệnh lại xảy ra chủ yếu ... O, A và Asia1. ổ dịch do virus týp Asia1 cũng đợc báo cáo ở Iran, Afganistan, Georgia và Azerbaizan; những ổ dịch do virus týp O gây ra đợc báo cáo ở một loạt các nớc nh Mông Cổ, Kuwait,...

Ngày tải lên: 02/08/2013, 13:56

... Dung 2 ABSTRACT Study on The circulation of FMDV (Foot and mouth disease virus) in pigs of Dong Thap province was carried out from March to October, 2011 at Chau Thanh, Cao Lanh and Tam Nong ... 50-100 heads had positive rate of 66.67% that was higher than smaller scale. 6/6 suspect samples and 1/6 swab sample were positive with FMDV type O. Keywords: Foot and mouth disease virus, pi...

Ngày tải lên: 20/03/2014, 08:21

... Sanyal, A. , Hemadri, D., Bandyopadhyay, S.K. Antigenic and genetic analyses of foot-and-mouth disease virus type A isolates for selection of candidate vaccine strain reveals emergence of a ... Foot and Mouth Disease in South-East Asia, Kota Kinabalu, Sabah, Malaysia, 913 March. 23. Hoffmann, B., Beer, M., Reid, S.M., Mertens, P., Oura, C .A. , van Rijn, P .A. , Slomka, M.J., Ban...

Ngày tải lên: 26/11/2013, 20:53

... c a cặp mồi 40 chu kỳ 50 giây 60 0 C Cặp mồi c a kit là: Cặp mồi Chuỗi (5 – 3)- FAM Prime forward AGATGCAGGARGACATGTCAA Prime reverse TTGTACCAGGGYTTGGCYT Probe AAACACGGACCCGACTTTAACCG ... Dimethylsulfoxide DNA Dinucleotide Acid dNTP DeoxyriboNucleotide Triphosphate EDTA Ethylene Diamine Tetra-acetic Acid ELISA Emzyme - Linked Immunosorbent Assay FAO Food and Agriculture Org...

Ngày tải lên: 14/12/2013, 16:28