cây sinh dòng virus lở mồm long móng serotybe a
... SaudiArabia/1992 (SAU/92) ,A2 2/Thailand/1993 (Thailand/93), Thailand/1996 (Thailand/96), Bilbao/Spain/1973 (Spain/73), A1 /Bavaria/ 1946 (A1 /Bavaria/46), A7 (5)/Greece/1954 (A7 /Greece/54) , BAN/2/87, ... MADHANMOHAN, P N RANGARAJAN and V A SRINIVASAN - November 19, 2001 4. Phylogenetic analysis of serotype A foot-and-mouth disease virus isolated in India between 1977 and 200...
Ngày tải lên: 22/02/2014, 19:28
... SaudiArabia/1992 (SAU/92) ,A2 2/Thailand/1993 (Thailand/93), Thailand/1996 (Thailand/96), Bilbao/Spain/1973 (Spain/73), A1 /Bavaria/ 1946 (A1 /Bavaria/46), A7 (5)/Greece/1954 (A7 /Greece/54) , BAN/2/87, ... MADHANMOHAN, P N RANGARAJAN and V A SRINIVASAN - November 19, 2001 4. Phylogenetic analysis of serotype A foot-and-mouth disease virus isolated in India between 1977 and 200...
Ngày tải lên: 22/03/2014, 12:20
... http://vi.wikipedia.org/wiki/L%E1%BB%9F_m%E1%BB%93m _long_ m%C3%B3ng 9. http://www.anova.com.vn/contents/article.asp?id=265&detail=16&ucat=42 10. DANIEL SA-CARVALHO, ELIZABETH RIEDER, BARRY BAXT,1 RENATO RODARTE, AMILCAR TANURI, AND ... W. MASON. Tissue Culture Adaptation of Foot-and-Mouth Disease Virus Selects Viruses That Bind to Heparin and Are Attenuated in Cattle. Plum Isl...
Ngày tải lên: 05/03/2014, 16:20
SỰ LƯU HÀNH CỦA VIRUS LỞ MỒM LONG MÓNG (FMDV) TRÊN HEO TẠI TỈNH ĐỒNG THÁP pptx
... Dung 2 ABSTRACT Study on The circulation of FMDV (Foot and mouth disease virus) in pigs of Dong Thap province was carried out from March to October, 2011 at Chau Thanh, Cao Lanh and Tam Nong ... 50-100 heads had positive rate of 66.67% that was higher than smaller scale. 6/6 suspect samples and 1/6 swab sample were positive with FMDV type O. Keywords: Foot and mouth disease virus, pi...
Ngày tải lên: 20/03/2014, 08:21
Luận văn xác định týp o virus lở mồm long móng ở việt nam bằng phương pháp RT PCR
... ph a Nam Tandania, Malauy, Zaia và Angola đều có dịch LMLM. Không có bệnh ở Mađagatca và động vật nuôi phổ biến ở Zimbabuê, Bốtxoana, Namibia và cộng hoà Nam Phi nhng bệnh lại xảy ra chủ yếu ... O, A và Asia1. ổ dịch do virus týp Asia1 cũng đợc báo cáo ở Iran, Afganistan, Georgia và Azerbaizan; những ổ dịch do virus týp O gây ra đợc báo cáo ở một loạt các nớc nh Mông Cổ, Kuwait,...
Ngày tải lên: 02/08/2013, 13:56
Nghiên cứu chế tạo bộ kit RT-PCR để chuẩn đoán virus lở mồm long móng (LMLM) đại diện đang lưu hành ở Việt Nam
... Sanyal, A. , Hemadri, D., Bandyopadhyay, S.K. Antigenic and genetic analyses of foot-and-mouth disease virus type A isolates for selection of candidate vaccine strain reveals emergence of a ... Foot and Mouth Disease in South-East Asia, Kota Kinabalu, Sabah, Malaysia, 913 March. 23. Hoffmann, B., Beer, M., Reid, S.M., Mertens, P., Oura, C .A. , van Rijn, P .A. , Slomka, M.J., Ban...
Ngày tải lên: 26/11/2013, 20:53
so sánh một số phương pháp phòng thí nghiệm chẩn đoán virus lở mồm long móng tại việt nam
... c a cặp mồi 40 chu kỳ 50 giây 60 0 C Cặp mồi c a kit là: Cặp mồi Chuỗi (5 – 3)- FAM Prime forward AGATGCAGGARGACATGTCAA Prime reverse TTGTACCAGGGYTTGGCYT Probe AAACACGGACCCGACTTTAACCG ... Dimethylsulfoxide DNA Dinucleotide Acid dNTP DeoxyriboNucleotide Triphosphate EDTA Ethylene Diamine Tetra-acetic Acid ELISA Emzyme - Linked Immunosorbent Assay FAO Food and Agriculture Org...
Ngày tải lên: 14/12/2013, 16:28
Tài liệu TIỂU LUẬN:CHẨN ĐOÁN VIRUS LỞ MỒM LONG MÓNG BẰNG KỸ THUẬT ELISA docx
... dịch lở mồm long móng Virus lở mồm long móng Gia súc mẫn cảm bệnh lở mồm long món g Kiểm soát vận chuyển qua biên giới quốc gia và vùng thiếu hiệu quả • Kiểm soát thiếu hiệu quả c a ... (vesicular atomati) rất giống bệnh lở mồm long móng, ở lợn, ngoài hai bệnh trên, còn có hai bệnh n a là bệnh mụn nước ở lợn (swine vesicular disease, SVD) và bệnh...
Ngày tải lên: 13/02/2014, 11:20
Khảo sát một số đặc điểm dịch tễ bệnh lở mồm long móng ở trâu, bò tại lâm đồng từ năm 2004 2009 và đánh giá hiệu quả sử dụng của vacxin
... domestical animal. Iowa Stae university Press. Ames, Iowa, USA. Foot and Mouth disease p199-205, Vesicular stomatitis p. 206-210. 53 Namdy S, (1996) Foot and mouth disease in wild animals. Asian ... tiếng Anh 33 Andersen (1980), Picornaviruses of animal: Clinical observations and diagnois, In Comparative Diagnosis of Viral Diseases, vol 3. In press. 34 Bachrach, H.L (1968), Foot and...
Ngày tải lên: 22/11/2013, 23:24
tăng cường khả năng giám sát và khống chế bệnh lở mồm long móng (lmlm) ở trâu , bò và heo góp phần nâng cao an toàn sinh học cho quốc gia
... CHẾ BỆNH LỞ MỒM LONG MÓNG (LMLM) Ở TRÂU , BÒ VÀ HEO GÓP PHẦN NÂNG CAO AN TOÀN SINH HỌC CHO QUỐC GIA Đơn vi thực hiện ph a Việt Nam : Trung Tâm Thú Y Vùng TP. Hồ Chí Minh ( Nay là Cơ Quan Thú ... Số ngày ở Việt Nam Số ngày ở Australia Số chuyến đi tới Việt Nam Chris Morrissy 15 Peter Daniels 2 Lynda Wright 10 Axel Colling 2 Catherine Williams 15 5 1 Total 15 34 1 11 ....
Ngày tải lên: 23/02/2014, 23:36