Sau khi phân tích, so sánh với trình tự của gen FLT3 gốc được cung cấp trên Genbank, trình tự chính xác của các đoạn ADN có kích thước lớn hơn 330 bp xác định được bằng quy trình đều giống với trình tự gen FLT3 gốc, tuy nhiên có thêm những đoạn lặp. Những đoạn ADN lặp đoạn này được chèn vào ngay cạnh đoạn gốc ở trong gen (FLT3-ITD). Các trình tự đó được trình bày trong bảng 3.5.
Bảng 3.5: Trình tự đột biến FLT3-ITD
Mẫu Trình tự đột biến Kích thước
20 CGTTGATTTCAGAGAATATGAATATGATCTCAA 33 bp 57 CTCTGAAATCAGTTTCTCTTGGAAACTCCCATTTGAGATCATAT TCATATT 51 bp 60d TTCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATA TGAATATGATCTCAAATGG 63 bp 69 TCATATTCTCTGAAATCAACGTAG 24 bp 71 AGTGATGAACGCACTAGCATATGGAGTTATCG 32 bp 88t CTCTGACACCAAACTCTAAATTTTCTCTTGGAAACTCCCATTTG AGATCATATTCATATT 60 bp
Các trình tự ADN trên được chuyển sang trình tự protein bằng cách sử dụng phần mềm BLAST-online, và được so sánh với trình tự protein gốc (Hình 3.8). Kết quả cho thấy các đột biến thường không làm thay đổi khung đọc mở, không làm thay đổi toàn bộ axit amin được mã hóa của mạch mà thường là lặp lại trọn vẹn một đoạn axit amin và chèn ngay vào cạnh đoạn bị lặp đó. Trong đó, điểm thường xảy ra đột biến nhất là giữa axitamin Leucine (L) và Lysine (K) chiếm 5/7 (71,4%) trong các đột biến xác định được. Riêng với mẫu 71, do đọc trình tự gen trực tiếp từ sản phẩm PCR tinh sạch còn một số Nucleotide chưa chính xác, nên trình tự protein chưa thể đưa ra kết luận chính xác được.
Hình 3.8. Trình tự protein một số mẫu chứa đột biến 3.5.4. Mức độ đột biến
Quan sát các băng điện di hình 3.4 cho thấy cường độ sáng của các băng rất khác nhau. Một số mẫu có băng thường có cường độ sáng cao hơn băng đột biến, trong khi, một số mẫu thì băng thường lại có cường độ sáng bằng hoặc thấp hơn băng đột biến. Điều đó cho thấy mức độ đột biến ở các mẫu rất khác nhau. Trong một số nghiên cứu trước đây, mức độ đột biến được định nghĩa là số lượng tế bào
cứu này, mức độ đột biến được tính toán tương đối dựa trên cường độ sáng của băng đột biến và băng thường trên bản gel điện di, sử dụng phần mềm ImmageJ.Mức độ đột biến được thể hiện bằng tỉ lệ phần trăm % cường độ sáng của băng ADN đột biến trên cường độ sáng tổng số (Bảng 3.6).
Bảng 3.6: Mức độ đột biến trên mẫu (%)
Mẫu 20 53 54 57 60 62 69 71 88 102 112 124 127 146 160
% 50 50 35 33 55 30 50 40 70 45 50 50 25 50 50
Bảng 3.6 cho thấy mức độ đột biến ở các mẫu khác nhau là khác nhau, nằm trong khoảng từ 25 – 70%. Ví dụ như mẫu 127, băng đột biến rất mờ so với băng thường, sau tính toán cho thấy mức độ đột biến của mẫu 127 là 25%. Trong khi đó, mẫu 88 có mức độ đột biến rất cao, đạt 70%, đồng thời, mẫu 88 lại có 2 băng đột biến. Sự khác nhau này sẽ ảnh hưởng rất nhiều đến tiên lượng bệnh cho bệnh nhân trong quá trình điều trị.
KẾT LUẬN
1. Đã thiết lập và tối ưu thành công quy trình phát hiện các đột biến trên gen FLT3gây ung thư bạch cầu cấp dòng tủy (đã được chuyển giao cho cơ sở y tế). 2. Sàng lọc quy mô phòng thí nghiệm cho thấy: tỷ lệ mẫu chứa đột biến gen FLT3- ITD là 15/200 mẫu chiếm 7,5% bệnh nhân AML. Số thứ tự của các mẫu đó là 20, 53, 54, 57, 60, 62, 69, 71, 88, 102, 112, 124, 127, 146, 160.
3. Các đột biến FLT3-ITD có kích thước từ 33 bp đến khoảng 70 -90 bp. Đoạn lặp ITD được chèn vào ngay cạnh đoạn gốc trong gen FLT3. Số lượng đột biến FLT3- ITD trong mỗi mẫu là từ 1-2 đột biến, tỉ lệ mẫu có 2 đột biến là 5/15 (33,3%).Mức độ đột biến ở các mẫu khác nhau là khác nhau, trong khoảng 25 - 70%.
KIẾN NGHỊ
1. Tiếp tục tối ưu quy trình xác định đột biến FLT3 - ITD (độ nhạy, độ chính xác, độ đặc hiệu của PCR...)
2. Tiến hành sàng lọc và phân tích các đột biến FLT3 - ITD trên lượng mẫu lớn hơn nhằm đưa ra con số thống kê có ý nghĩa thực tế hơn.
3. Tối ưu quy trình và sàng lọc các đột biến khác như đột biến FLT3-TKD trên gen FLT3 bằng phương pháp PCR kết hợp với cắt enzyme giới hạn.
TÀI LIỆU THAM KHẢO
Tiếng Việt
1. Kiều Thị Vân Anh, Vũ Minh Phương, Nguyễn Thiên Lữ, Phạm Quang Vinh
(2012), “Bước đầu nghiên cứu gen NPM1 - muta và FLT3-ITD trên bệnh nhân Lơ xê mi cấp dòng tủy”, Y học Việt Nam, 392, tr.64-68.
2. Trần Thái Bình, Lâm Thị Mỹ (2005). Giá trị phương pháp hình thái học - hoá
tế bào so với phương pháp dấu ấn miễn dịch trong chẩn đoán phân dòng leucemi cấp ở trẻ em. Y học TP. Hồ Chí Minh 9 (Sup.1): 59-64.
3. Nguyễn Phương Liên, Nguyễn Tấn Bỉnh (2007),“Phân loại bệnh bạch cầu cấp
bằng dấu ấn miễn dịch tế bào”,Y học TP. Hồ Chí Minh, 11(1): 34-39
4. Phan Nguyễn Thanh Vân (2013), Ứng dụng kỹ thuật khuếch đại gien khảo sát
các tổ hợp gien thường gặp trong bệnh lý bạch cầu cấp, Luận án tiến sĩ y học, Đại học Y Dược Thành phố Hồ Chí Minh.
Tiếng Anh
5. Ammatuna E., Noguera N.I., Zangrilli D., Curzi P., Panetta P., Bencivenga P., Amadori S., Federici G., and Lo-Coco F. (2005), “Rapid detection of nucleophosmin (NPM1) mutations in acute myeloid leukemia by denaturing HPLC”, Clinical chemistry, 51 (11), pp. 2165-2167.
6. Bagrintseva K., Geisenhof S., Kern R., Eichenlaub S., Reindl C., Ellwart J.W., Hiddemann W., and Spiekermann K. (2005), “FLT3-ITD-TKD dual mutants associated with AML confer resistance to FLT3 PTK inhibitors and cytotoxic agents by overexpression of Bcl-x(L)”, Blood, 105 (9), pp. 3679- 3685.
7. Barjesteh Van Waalwijk Van Doorn-Khosrovani S., Erpelinck C., Meijer J.,
D.G., Lowenberg B., and Delwel R. (2003), “Biallelic mutations in the CEBPA gene and low CEBPA expression levels as prognostic markers in intermediate-risk AML”, Hematology Journal 4(1), pp. 31-40.
8. Barry E.V., Clark J.J., Cools J., Roesel J., and Gilliland D.G. (2007), “Uniform sensitivity of FLT3 activation loop mutants to the tyrosine kinase inhibitor midostaurin”, Blood, 110 (13), pp. 4476-4479.
9. Boonthimat C., Identification of NPM1 mutation and its prognostic impact in thai adult acute myeloid leukemia, in Faculty of Graduate Studies. 2008, Mahidol: Mahidol University. p. 133.
10. Busque L. and Gilliland D.G. (1993), “Clonal evolution in acute myeloid leukemia”, Blood, 82 (2), pp. 337-342.
11. Cairoli R., Beghini A., Grillo G., Nadali G., Elice F., Ripamonti C.B., Colapietro P., Nichelatti M., Pezzetti L., Lunghi M., Cuneo A., Viola A., Ferrara F., Lazzarino M., Rodeghiero F., Pizzolo G., Larizza L., and Morra E. (2006), “Prognostic impact of c-KIT mutations in core binding factor leukemias: an Italian retrospective study”, Blood, 107 (9), pp. 3463-3468. 12. Clark J.J., Cools J., Curley D.P., Yu J.C., Lokker N.A., Giese N.A., and
Gilliland D.G. (2004), “Variable sensitivity of FLT3 activation loop mutations to the small molecule tyrosine kinase inhibitor MLN518”, Blood, 104 (9), pp. 2867-2872.
13. Cools J., Mentens N., Furet P., Fabbro D., Clark J.J., Griffin J.D., Marynen P., and Gilliland D.G. (2004), “Prediction of resistance to small molecule FLT3 inhibitors: implications for molecularly targeted therapy of acute leukemia”, Cancer research, 64 (18), pp. 6385-6389.
14. Dohner K., Schlenk R.F., Habdank M., Scholl C., Rucker F.G., Corbacioglu
A., Bullinger L., Frohling S., and Dohner H. (2005), “Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations”,
15. Falini B., Mecucci C., Tiacci E., Alcalay M., Rosati R., Pasqualucci L., La Starza R., Diverio D., Colombo E., Santucci A., et al. (2005), “Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype”,
New England Journal of Medicine, 352 (3), pp. 254-266.
16. Fröhling S., Scholl C., Levine R.L., Loriaux M., Boggon T.J., Bernard O.A., Berger R., Döhner H., Döhner K., Ebert B.L., et al. (2007), “Identification of driver and passenger mutations of FLT3 by high-throughput DNA sequence analysis and functional assessment of candidate alleles”, Cancer cell, 12 (6), pp. 501-513.
17. Gilliland D.G. (2003), “FLT3-activating mutations in acute promyelocytic leukaemia: a rationale for risk-adapted therapy with FLT3 inhibitors”, Best Practice & Research Clinical Haematology, 16 (3), pp. 409-417.
18. Gilliland D.G. and Griffin J.D. (2002), “Role of FLT3 in leukemia”, Current opinion in hematology, 9 (4), pp. 274-281.
19. Gilliland D.G. and Griffin J.D. (2002), “The roles of FLT3 in hematopoiesis and leukemia”, Blood, 100 (5), pp. 1532-1542.
20. Ho P.A., Alonzo T.A., Gerbing R.B., Pollard J., Stirewalt D.L., Hurwitz C., Heerema N.A., Hirsch B., Raimondi S.C., Lange B., Franklin J.L., Radich J.P., and Meshinchi S. (2009), “Prevalence and prognostic implications of CEBPA mutations in pediatric acute myeloid leukemia (AML): a report from the Children's Oncology Group”, Blood, 113 (26), pp. 6558-6566.
21. Jiang J., Paez J.G., Lee J.C., Bo R., Stone R.M., Deangelo D.J., Galinsky I., Wolpin B.M., Jonasova A., Herman P., Fox E.A., Boggon T.J., Eck M.J., Weisberg E., Griffin J.D., Gilliland D.G., Meyerson M., and Sellers W.R. (2004), “Identifying and characterizing a novel activating mutation of the FLT3 tyrosine kinase in AML”, Blood, 104 (6), pp. 1855-1858.
22. Kelly L.M., Yu J.-C., Boulton C.L., Apatira M., Li J., Sullivan C.M., Williams I., Amaral S.M., Curley D.P., Duclos N., Neuberg D., Scarborough R.M., Pandey A., Hollenbach S., Abe K., Lokker N.A., Gilliland D.G., and
Giese N.A. (2002), “CT53518, a novel selective FLT3 antagonist for the treatment of acute myelogenous leukemia (AML)”, Cancer cell, 1 (5), pp. 421-432.
23. Kesarwani M., Huber E., and Azam M. (2013), “Overcoming AC220
resistance of FLT3-ITD by SAR302503”, Blood Cancer Journal, 3, pp. e138.
24. Kim H.-J., Ahn H., Jung C., Moon J., Park C.-H., Lee K.-O., Kim S.-H., Kim
Y.-K., Kim H.-J., Sohn S., Kim S., Lee W., Kim K., Mun Y.-C., Kim H., Park J., Min W.-S., Kim H.-J., and Kim D. (2013), “KIT D816 mutation associates with adverse outcomes in core binding factor acute myeloid
leukemia, especially in the subgroup with RUNX1/RUNX1T1
rearrangement”, Ann Hematol, 92 (2), pp. 163-171.
25. Kim Y.K., Kim H.N., Lee S.R., Ahn J.S., Yang D.H., Lee J.J., Lee I.K., Shin M.G., and Kim H.J. (2010), “Prognostic significance of nucleophosmin mutations and FLT3 internal tandem duplication in adult patients with
cytogenetically normal acute myeloid leukemia”, Korean Journal of
Hematology, 45 (1), pp. 36-45.
26. Kiyoi H., Naoe T., Nakano Y., Yokota S., Minami S., Miyawaki S., Asou N.,
Kuriyama K., Jinnai I., Shimazaki C., Akiyama H., Saito K., Oh H., Motoji T., Omoto E., Saito H., Ohno R., and Ueda R. (1999), “Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia”,
Blood, 93 (9), pp. 3074-3080.
27. Kiyoi H., Towatari M., Yokota S., Hamaguchi M., Ohno R., Saito H., and Naoe T. (1998), “Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product”, Leukemia, 12 (9), pp. 1333-1337.
28. Kohler G. and Milstein C. (1975), “Continuous cultures of fused cells secreting antibody of predefined specificity”, Nature, 256 (5517), pp. 495- 497.
29. Kronke J., Bullinger L., Teleanu V., Tschurtz F., Gaidzik V.I., Kuhn M.W., Rucker F.G., Holzmann K., Paschka P., Kapp-Schworer S., et al. (2013), “Clonal evolution in relapsed NPM1-mutated acute myeloid leukemia”,
Blood, 122 (1), pp. 100-108.
30. Lee B.H., Tothova Z., Levine R.L., Anderson K., Buza-Vidas N., Cullen D.E., Mcdowell E.P., Adelsperger J., Frohling S., Huntly B.J., Beran M., Jacobsen S.E., and Gilliland D.G. (2007), “FLT3 mutations confer enhanced proliferation and survival properties to multipotent progenitors in a murine model of chronic myelomonocytic leukemia”, Cancer cell, 12 (4), pp. 367- 380.
31. Lin L.I., Chen C.Y., Lin D.T., Tsay W., Tang J.L., Yeh Y.C., Shen H.L., Su
F.H., Yao M., Huang S.Y., and Tien H.F. (2005), “Characterization of CEBPA mutations in acute myeloid leukemia: most patients with CEBPA mutations have biallelic mutations and show a distinct immunophenotype of the leukemic cells”, Clinical Cancer Research, 11 (4), pp. 1372-1379.
32. Lu C., Ward P.S., Kapoor G.S., Rohle D., Turcan S., Abdel-Wahab O., Edwards C.R., Khanin R., Figueroa M.E., Melnick A., Wellen K.E., O'rourke D.M., Berger S.L., Chan T.A., Levine R.L., Mellinghoff I.K., and Thompson C.B. (2012), “IDH mutation impairs histone demethylation and results in a block to cell differentiation”, Nature, 483 (7390), pp. 474-478.
33. Ly B.T.K., Chi H.T., Yamagishi M., Kano Y., Hara Y., Nakano K., Sato Y.,
and Watanabe T. (2013), “Inhibition of FLT3 expression by green tea catechins in FLT3 mutated-AML cells”, PLoS ONE, 8 (6), pp. 1-9.
34. Malek S.N., Update on the molecular biology of myelogenous leukemia: clinical implications 2011: American Society of Clinical Oncology p. 231- 236.
35. Marcucci G., Maharry K., Wu Y.Z., Radmacher M.D., Mrozek K., Margeson
D., Holland K.B., Whitman S.P., Becker H., Schwind S., et al. (2010), “IDH1 and IDH2 gene mutations identify novel molecular subsets within de
novo cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B study”, Journal of Clinical Oncology, 28 (14), pp. 2348- 2355.
36. Meshinchi S. and Appelbaum F.R. (2009), “Structural and functional
alterations of FLT3 in acute myeloid leukemia”, Clinical Cancer Research, 15 (13), pp. 4263-4269.
37. Meshinchi S., Stirewalt D.L., Alonzo T.A., Boggon T.J., Gerbing R.B., Rocnik J.L., Lange B.J., Gilliland D.G., and Radich J.P. (2008), “Structural and numerical variation of FLT3/ITD in pediatric AML”, Blood, 111 (10), pp. 4930-4933.
38. Murphy K.M., Levis M., Hafez M.J., Geiger T., Cooper L.C., Smith B.D., Small D., and Berg K.D. (2003), “Detection of FLT3 internal tandem duplication and D835 mutations by a multiplex polymerase chain reaction and capillary electrophoresis assay”, Journal of Molecular Diagnostic, 5 (2), pp. 96-102.
39. Nadler L.M., Stashenko P., Hardy R., Kaplan W.D., Button L.N., Kufe D.W., Antman K.H., and Schlossman S.F. (1980), “Serotherapy of a patient with a monoclonal antibody directed against a human lymphoma-associated antigen”, Cancer research, 40 (9), pp. 3147-3154.
40. Nakao M., Janssen J.W., Erz D., Seriu T., and Bartram C.R. (2000), “Tandem duplication of the FLT3 gene in acute lymphoblastic leukemia: a marker for the monitoring of minimal residual disease”, Leukemia, 14 (3), pp. 522-524.
41. Noguera N.I., Ammatuna E., Zangrilli D., Lavorgna S., Divona M.,
Buccisano F., Amadori S., Mecucci C., Falini B., and Lo-Coco F. (2005), “Simultaneous detection of NPM1 and FLT3-ITD mutations by capillary electrophoresis in acute myeloid leukemia”, Leukemia, 19 (8), pp. 1479- 1482.
42. Pressman D. and Korngold L. (1953), “The in vivo localization of anti- Wagner-osteogenic-sarcoma antibodies”, Cancer, 6 (3), pp. 619-623.
43. Ravandi F., Alattar M.L., Grunwald M.R., Rudek M.A., Rajkhowa T., Richie
M.A., Pierce S., Daver N., Garcia-Manero G., Faderl S., et al. (2013), “Phase 2 study of azacytidine plus sorafenib in patients with acute myeloid leukemia and FLT-3 internal tandem duplication mutation”, Blood, 121 (23), pp. 4655- 4662.
44. Renneville A., Roumier C., Biggio V., Nibourel O., Boissel N., Fenaux P., and Preudhomme C. (2008), “Cooperating gene mutations in acute myeloid leukemia: a review of the literature”, Leukemia, 22 (5), pp. 915-931.
45. Schnittger S., Schoch C., Dugas M., Kern W., Staib P., Wuchter C., Loffler
H., Sauerland C.M., Serve H., Buchner T., Haferlach T., and Hiddemann W. (2002), “Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in the AMLCG study and usefulness as a marker for the detection of minimal residual disease”, Blood, 100 (1), pp. 59-66.
46. Small D. (2006), “FLT3 mutations: biology and treatment”, American
Society of Hematology, pp. 178-184.
47. Steudel C., Wermke M., Schaich M., Schäkel U., Illmer T., Ehninger G., and
Thiede C. (2003), “Comparative analysis of MLL partial tandem duplication and FLT3 internal tandem duplication mutations in 956 adult patients with acute myeloid leukemia”, Genes, Chromosomes and Cancer, 37 (3), pp. 237- 251.
48. Stirewalt D.L., Kopecky K.J., Meshinchi S., Appelbaum F.R., Slovak M.L.,
Willman C.L., and Radich J.P. (2001), “FLT3, RAS, and TP53 mutations in elderly patients with acute myeloid leukemia”, Blood, 97 (11), pp. 3589- 3595.
49. Stirewalt D.L. and Radich J.P. (2003), “The role of FLT3 in haematopoietic
50. Tallman M.S. (2005), “New strategies for the treatment of acute myeloid leukemia including antibodies and other novel agents”, Hematology / the Education Program of the American Society of Hematology. American Society of Hematology. Education Program, pp. 143-150.
51. Thiede C., Steudel C., Mohr B., Schaich M., Schakel U., Platzbecker U., Wermke M., Bornhauser M., Ritter M., Neubauer A., Ehninger G., and Illmer T. (2002), “Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: association with FAB subtypes and identification of subgroups with poor prognosis”, Blood, 99 (12), pp. 4326- 4335.
52. Vardiman J.W., Harris N.L., and Brunning R.D. (2002), “The World Health
Organization (WHO) classification of the myeloid neoplasms”, Blood, 100 (7), pp. 2292-2302.
53. Vardiman J.W., Thiele J., Arber D.A., Brunning R.D., Borowitz M.J., Porwit
A., Harris N.L., Le Beau M.M., Hellstrom-Lindberg E., Tefferi A., and Bloomfield C.D. (2009), “The 2008 revision of the World Health