§ 721 3 what categories of activities are preapproved as incidental powers necessary or requisite to carry on a credit union s business

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Ngày tải lên : 08/03/2014, 22:20
... yeast Pichia pastoris, catalyzed the degradation of a synthetic substrate containing a papain-cleavage site, as well as other proteins Moreover, a protein with strong proteolytic activity was ... restriction enzymes were obtained from New England Biolabs, Beverly, MA, USA Pichia-transformation, identification of transformants, and expression Transformation of P pastoris strains GS115 and PEP4(thus ... and family 45 hydrolases fail to catalyze expansin-like wall extension [17] A similarity of the C-terminal region of expansins to CBDs of bacterial cellulases was further suggested on the basis...
  • 10
  • 535
  • 0
Báo cáo lâm nghiệp: " On the niche breadth of Fagus sylvatica: soil nutrient status in 50 Central European beech stands on a broad range of bedrock types" potx

Báo cáo lâm nghiệp: " On the niche breadth of Fagus sylvatica: soil nutrient status in 50 Central European beech stands on a broad range of bedrock types" potx

Ngày tải lên : 08/08/2014, 00:22
... Limestone Claystone Claystone Claystone Claystone Claystone Claystone Claystone Claystone Sandstone Sandstone Sandstone Sandstone Sandstone Sandstone Sandstone Sandstone Sand Sand Sand Sand Loess ... deposits (Tab I) The soils are mainly Umbrisols (on sands, sandstones, and glacial deposits), Cambisols (on claystones, limestones, and loess), and Leptosols (on sandstones and limestones) in a variety ... O 5.4 to 5.6) through the claystones (4.7 to 5 .3) and the sandstone, sand and loess sites (3. 3 to 4 .3) to the glacial sands and loams (3. 3 to 3. 7, Fig 1a) The increase in acidity was paralleled...
  • 14
  • 382
  • 0
Tài liệu Activity 3.1: Identifying Categories of Information ppt

Tài liệu Activity 3.1: Identifying Categories of Information ppt

Ngày tải lên : 24/01/2014, 10:20
... below, list examples for your assigned category Write down as many examples as possible in the time given Choose a presenter from the group to discuss the group s results in class Category assigned ... 16 Activity 3. 1: Identifying Categories of Information Exercise 1: Identifying Categories ! Write down the examples of information in your category Participate in small groups as assigned ... the instructor Review the description of the category assigned by the instructor to the group Review the case study and analyze it to find the information related to the category In the space below,...
  • 2
  • 279
  • 0
What qualities and skills are needed for the managers to manage people?• What is the importance of good human resources management

What qualities and skills are needed for the managers to manage people? • What is the importance of good human resources management

Ngày tải lên : 08/07/2014, 10:33
... important task of managers to promote organization to operate better 2 Conflict resolution  There are many kinds of conflict, a good manager is a person who can aware what are the best ways to resolve ... encourage members to exchange ideas  The ability to listen well is a cornerstone of good leadership 3 LEADERSHIP Manager owns leadership skills are able to motivate work groups to achieve all ... chose them you chose them You have to trust in You have to trust in subordinates subordinates staff to see if they have staff to see if they have any questions or any questions or concerns that...
  • 33
  • 3.9K
  • 10
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Ngày tải lên : 09/08/2014, 10:22
... U test All data are expressed as the mean ± standard deviation Statistical analysis was performed using SPSS 10.0 for Windows (SPSS, Chicago, IL, USA) The differences between groups were analyzed ... incubation Reverse transcription–polymerase chain reaction analysis of indoleamine 2 ,3- dioxygenase and Foxp3 expression Total RNA (2 μg) was reverse transcribed into cDNA using a transcription ... magnetic-activated cell sorting system The expression of IDO mRNA was analyzed using RT-PCR β2-Actin was used as an internal control Each value is the mean ± standard deviation of replicate determinations...
  • 10
  • 473
  • 0
Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?

Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?

Ngày tải lên : 26/12/2014, 08:36
... favorable conditions for joint work • • a manager has to improve themselves and makes an effort to meet the employees’ expectation A good manager always put the interests of employees first.And ... easiest way to be brave and fearless is to listen to and follow your heart To further your level of success you must establish a system for self-encouragement 1.Pursue activities that you feel passionate ... levels of management and all employees in the company 3.  Evoke and establish collective spirit  Managers encourage employees to work as a team It develops a team spirit in the organisation This...
  • 16
  • 1.4K
  • 1
OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells

OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells

Ngày tải lên : 27/11/2015, 11:25
... controversial as some contradictory reports suggest the necessity of a sustained expression of Oct -3/ 4 (also known as Pou5F1) for neurogenesis (Shimozaki et al., 20 03) and that constitutive Sox-2 ... oligos, mock transfection) and the various siRNAs are shown β-Actin serves as a loading control 30 A FAM siOct -A 10X B siSox -A siSox-B FAM siOct -A 50X siSox -A siSox-B Figure 12 Trophectodermal ... feedback on submitted manuscripts and thesis revisions Thanks to MSc supervisor, Dr Andre Choo, for his suggestions and insight as well as Dr Steve Oh for his patience and providing motivation to...
  • 88
  • 344
  • 0
TCHON AV9 HKII PERIOD 3  ADVERB CLAUSES OF REASON

TCHON AV9 HKII PERIOD 3 ADVERB CLAUSES OF REASON

Ngày tải lên : 20/07/2013, 01:28
... Verb Noun Adjective Adverb Meaning Fluency Fluent Fluently Trôi chảy care Care/ carefulness/ Careful/careles carefully/ Bất / can carelessness s carelessly ( thận) hardness hard Hard/ hardly Chăm ... ( Forest / Forestry / Deforestation / Forests) We …………… up our neighborhood when that conservationist arrived ( cleaned/ cleaning/ are cleaning/ were cleaning) …… .are used to kill inserts and ... goodness good well Tốt heavily heavy heavily Nặng nề Pleasure Pleasant/ pleasingly Vui s ớng Pleased pollut pollution polluted Ô nhiễm e He got 10 marks in the English speaking test because he speaks...
  • 3
  • 1.3K
  • 28
EVALUATION OF THE REAL SITUATION OF IMPORT ACTIVITIES OF VIETNAM ENERGY DEVELOPMENT SUPPORT JOINT STOCK COMPANY FROM 2009 TO 2011.  PROBLEMS AND SOLUTIONS.

EVALUATION OF THE REAL SITUATION OF IMPORT ACTIVITIES OF VIETNAM ENERGY DEVELOPMENT SUPPORT JOINT STOCK COMPANY FROM 2009 TO 2011. PROBLEMS AND SOLUTIONS.

Ngày tải lên : 24/07/2013, 09:11
... operations, organizational structure in accordance with the rules in the markets they operate in 2.2.2 Internal factors In contrast to external factors, internal factors are factors that businesses ... quality guarantee - Sustainable relationships and partnership with business partners and customers - Employees’ benefits guarantee 1 .3 Organizational Structure As a small-scale enterprise, VEDS ... agreement on foreign trade, International trade customs and national law - Trading methods on international market are diversified: ordinary transaction, mediated transaction or transaction at fairs...
  • 49
  • 894
  • 2
Tài liệu Microsoft PowerPoint - Day 3 Afternoon - Use of charts- V doc

Tài liệu Microsoft PowerPoint - Day 3 Afternoon - Use of charts- V doc

Ngày tải lên : 16/01/2014, 22:20
... x a mù chữ Một s biểu đồ s dụng Báo cáo Giám s t To n cầu 33 34 17 Phân tích s liệu Báo cáo GSTC – Một s điểm nhấn mạnh Phân tích s liệu Báo cáo GSTC – Một s điểm nhấn mạnh Tình hình x a ... 97.0 Dac Lak Khanh Hoa Binh Phuoc Lam Dong Ninh Thuan Trình bày ong Dong Nai Xu hướng Đối chiếu Kết quả, tiến độ Giá trị tuyệt đối, tương đối Phạm vi, phần trăm BinhThuan Central Highlands Màu, ... Việt Nam Ai người bạn trình bày thông tin? Quang Ngai Trình độ hiểu biết Quan tâm họ gì? Kon Tum Binh Dinh Vai trò biểu đồ (Chính xác bạn muốn nói điều gì) Gia Lai Rate Phu Yen 18.9 - 38 .4 38 .5...
  • 28
  • 379
  • 0
Tài liệu Activity 3.3: Using Perspectives of Information pdf

Tài liệu Activity 3.3: Using Perspectives of Information pdf

Ngày tải lên : 24/01/2014, 10:20
... 20 Activity 3. 3: Using Perspectives of Information Exercise 1: Identifying Perspectives in Information ! Develop questions from business and user perspectives Work in small groups as assigned ... information is currently present and what additional information you would want to gather for a perspective For example, what information is applicable to the technology category from a user and business ... instructor Review the Time and Billing section in the case study In the space below, state the category of information, the topic, and the source (s) that provide information on the category For...
  • 2
  • 283
  • 0
Tài liệu 3 Parameter Setting of Analog Speed Controllers pdf

Tài liệu 3 Parameter Setting of Analog Speed Controllers pdf

Ngày tải lên : 27/01/2014, 15:20
... semiconductor power switches (such as transistors and thyristors), inductances, and capacitors It changes the AC voltages obtained from the mains into the voltages and currents required for the DC motor ... disturbance Under these assumptions, the transfer function WA (s) of the voltage-supplied DC motor, employed as the torque actuator, is given in Eq 3. 6 The transfer function has the static gain ... is shown The figure includes the secondary phenomena, such as the speed-feedback acquisition dynamics WM (s) and delays in the torque generation WA (s) It is assumed that the process of speed acquisition...
  • 28
  • 331
  • 0
evaluate effectiveness of customer service activities in increasing sales for kichi-kichi hot pot bar restaurant on 61 ma may street

evaluate effectiveness of customer service activities in increasing sales for kichi-kichi hot pot bar restaurant on 61 ma may street

Ngày tải lên : 17/02/2014, 12:43
... asks for the combination of many factors and among them, customer service plays an important role In the service sector, customer satisfaction is a decisive factor with the existence of a business ... promotion products are a difficult question to many businesses What are promotional products? Promotional products are items as diverse as pens, golf balls, bags, key chains, shirts and coffee mugs ... gives people reasons to spend their money with your business Explore various types of traditional advertising methods such as classified ads, yellow page ads, television and radio spots, and display...
  • 38
  • 830
  • 3
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Ngày tải lên : 18/02/2014, 16:20
... bovine serum in a humidified incubator at 37 °C in 10% CO2 Stable transfection of expression vectors into AtT-20 cells was carried out by electroporation as previously described [3] Selection of stable ... Discussion Many peptide hormones (such as insulin, ACTH and others) are only bioactive after selective cleavage of their precursor proteins in secretory granules by PC enzymes such as PC1 ⁄ 3, ... proteins: prosomatostatin contains an a- helix in its N-terminal region that is sufficient for targeting to secretory granules [12] Carboxypeptidase E also contains an a- helix in its C-terminus that...
  • 9
  • 600
  • 0
Báo cáo khoa học: Many fructosamine 3-kinase homologues in bacteria are ribulosamine⁄erythrulosamine 3-kinases potentially involved in protein deglycation docx

Báo cáo khoa học: Many fructosamine 3-kinase homologues in bacteria are ribulosamine⁄erythrulosamine 3-kinases potentially involved in protein deglycation docx

Ngày tải lên : 07/03/2014, 05:20
... GGCAGCGGATCCTAGCAAATAATATCTTTTAATTTTAAAA GCAGCGCATATGGACCGGCCCGTGCGCGT GGCAGCAGATCTCAAGCCCGGCCTTCCGCAG GTTCATATGCACTTAACAAAAACTTGG GAGGGATCCATTAATATTGCATGAGAATTC AACATATGGATATCCAAACTGTTTTATC GCGGATCCCTTAAAAATTTTCTAGTAATTG TTCATATGAATGAACAATGGTTAGAG ... Phosphorylation of alpha-glycated amino acids was assayed spectrophotometrically by measuring the release of ADP through the pyruvate kinase ⁄ lactate dehydrogenase coupled assay [ 13] Phosphatase activities ... genomes was used to search for homologues of human FN3K using tBLASTn and the protein database was also searched using PSI-BLAST [29] Only the sequences with a score of > 50 were considered as FN3K...
  • 15
  • 533
  • 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Ngày tải lên : 08/03/2014, 08:20
... TCG AGC CCC -3 ; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG -3 ) representing base pairs 1 830 –1881 of the MARCKS cDNA [38 ] ... defined amounts of BSA standards after Coomassie Blue staining Gel retardation assay The interaction of recombinant Hu-proteins with RNA transcripts were analyzed by gel retardation assays described ... stabilize ARE- containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated protein kinase has been associated with...
  • 16
  • 754
  • 0
Báo cáo khoa học: "MACHINE TRANSLATION : WHAT TYPE OF POST-EDITING ON WHAT TYPE OF DOCUMENTSFOR WHAT TYPE OF USERS" pdf

Báo cáo khoa học: "MACHINE TRANSLATION : WHAT TYPE OF POST-EDITING ON WHAT TYPE OF DOCUMENTSFOR WHAT TYPE OF USERS" pdf

Ngày tải lên : 08/03/2014, 18:20
... on isolated words, errors on the expression of relations, errors on the structure and on the information display These tables : errors are classified in Post-editing is not revision, nor correction, ... determinants, verbal modificators ; 2.5 verb forms (tense), 2.6 verb forms (passive/active) and personalization (passive/non personai), 2.7 expression of modaIity or not, 2.8 negation ; 3. 9 logical ... introduced in order to get a past tense for a present tense (or reverse), a passive form for an impersonaI one (or reverse), a. s. o First group includes all post-editing that has to be done to make the...
  • 3
  • 359
  • 0
Statute Prevents State Agencies From Considering Community Benefits When Granting Tax‑Exempt Status, While the Effects of Purchases and Consolidations on Prices of Care Are Uncertain ppt

Statute Prevents State Agencies From Considering Community Benefits When Granting Tax‑Exempt Status, While the Effects of Purchases and Consolidations on Prices of Care Are Uncertain ppt

Ngày tải lên : 15/03/2014, 23:20
... uses a survey review worksheet to examine individual exemption claim records for proper classification by the county assessors and to ask questions of assessors’ personnel on their practices and ... income and corporation taxes State law authorizes the tax board to issue the rulings and regulations that are necessary and reasonable to carry out the provisions related to organizations—including ... assets State regulation specifies that such an agreement or transaction involves a material amount of assets or operations when more than 20 percent of the hospital s assets or operations are...
  • 46
  • 439
  • 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Ngày tải lên : 17/03/2014, 17:20
... 5¢-FAM-labeled 29 base DNA 13- RNA4-DNA12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG -3 ) and DNA15RNA1-DNA 13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG -3 ) with a 1.5 molar equivalent of the complementary DNA, respectively, ... because the corresponding mutation in Hs-RNASEH 2A has been identified as one of the disease-causing mutations [30 ] Tk-G1 0A was constructed because Ala has the smallest side chain among all amino ... Conclusion In the present study, we used Sc-RNase H2* and Tk-RNase HII as model proteins to analyze the effect Mutations of yeast RNase H2 and archaeal RNase HII of a disease-causing mutation on the...
  • 14
  • 482
  • 0
The People of Forever Are Not Afraid by Shani Boianjiu doc

The People of Forever Are Not Afraid by Shani Boianjiu doc

Ngày tải lên : 22/03/2014, 09:20
... commander passes by me, waving the tiny banana, I can smell it Bananas Bananas and sand “I can smell bananas and—” I say My voice vibrates inside of the mask My words, they fail me I want to talk ... plastic My father is wearing his mask, and my baby sister is on the carpet inside a gas-​­ protective incubator, because she is too small for a mask of her own Dan keeps on taking his mask off, ... has to make up a new one What is your earliest memory?” she asks It is a question they used to ask before someone was brilliant enough to come up with the mom and dad question I don’t leave on...
  • 17
  • 362
  • 0

Xem thêm