Báo cáo khoa học: Many fructosamine 3-kinase homologues in bacteria are ribulosamine⁄erythrulosamine 3-kinases potentially involved in protein deglycation docx

Many fructosamine 3-kinase homologues in bacteria are ribulosamine⁄erythrulosamine 3-kinases potentially involved in protein deglycation Rita Gemayel, Juliette Fortpied, Rim Rzem, Didier Vertommen, Maria Veiga-da-Cunha and Emile Van Schaftingen ´ Universite Catholique de Louvain, de Duve Institute, Brussels, Belgium Keywords deglycation; erythrose 4-phosphate; fructosamine; glycation; ribose 5-phosphate Correspondence E Van Schaftingen, UCL 7539, Avenue Hippocrate 75, B-1200 Brussels, Belgium Fax: +32 27 647598 Tel: +32 27 647564 E-mail: vanschaftingen@bchm.ucl.ac.be (Received 11 April 2007, revised 15 June 2007, accepted 18 June 2007) doi:10.1111/j.1742-4658.2007.05948.x The purpose of this work was to identify the function of bacterial homologues of fructosamine 3-kinase (FN3K), a mammalian enzyme responsible for the removal of fructosamines from proteins FN3K homologues were identified in  200 (i.e  27%) of the sequenced bacterial genomes In 11 of these genomes, from phylogenetically distant bacteria, the FN3K homologue was immediately preceded by a low-molecular-weight protein-tyrosine-phosphatase (LMW-PTP) homologue, which is therefore probably functionally related to the FN3K homologue Five bacterial FN3K homologues (from Escherichia coli, Enterococcus faecium, Lactobacillus plantarum, Staphylococcus aureus and Thermus thermophilus) were overexpressed in E coli, purified and their kinetic properties investigated Four were ribulosamine ⁄ erythrulosamine 3-kinases acting best on free lysine and cadaverine derivatives, but not on ribulosamines bound to the alpha amino group of amino acids They also phosphorylated protein-bound ribulosamines or erythrulosamines, but not protein-bound fructosamines, therefore having properties similar to those of mammalian FN3K-related protein The E coli FN3K homologue (YniA) was inactive on all tested substrates The LMW-PTP of T thermophilus, which forms an operon with an FN3K homologue, and an LMW-PTP of S aureus (PtpA) were overexpressed in E coli, purified and shown to dephosphorylate not only protein tyrosine phosphates, but protein ribulosamine 5-phosphates as well as free ribuloselysine 5-phosphate and erythruloselysine 4-phosphate These LMW-PTPs were devoid of ribulosamine 3-phosphatase activity It is concluded that most bacterial FN3K homologues are ribulosamine ⁄ erythrulosamine 3-kinases They may serve, in conjunction with a phosphatase, to deglycate products of glycation formed from ribose 5-phosphate or erythrose 4-phosphate Fructosamine 3-kinase (FN3K) is a recently identified enzyme that phosphorylates the Amadori products fructosamines, leading to their destabilization and removal from proteins [1–3] FN3K is therefore responsible for a new protein-repair mechanism A related mammalian enzyme (FN3K-related protein; FN3K-RP) sharing 65% sequence identity with FN3K does not phosphorylate fructosamines, but does phosphorylate other ketoamines, mainly ribulosamines and erythrulosamines [4–6], as does the plant homologue of FN3K [6] Fructosamines arise through a spontaneous reaction of glucose with amines and their formation in vivo is Abbreviations DEAE, diethylaminoethyl; FN3K, fructosamine 3-kinase; FN3K-RP, FN3K-related protein; LMW-PTP, low-molecular-weight protein-tyrosinephosphatase; SP, sulfopropyl 4360 FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al Bacterial fructosamine 3-kinase homologues Results Protein NH2 H2O Search of FN3K homologues in databases NH2 HC O CH2 HCOH C O HCOH HCOH HCOH O CH2 O P OORibose-5-P HCOH O H2O CH2 O P OORibulosamine-5-P LMW-PTP NH Pi CH2 C O HCOH FN3K NH2 + HC O NH2 HCH Pi C O O HC O P OH2O HCOH O CH2OH 4,5-dihydroxy1,2-pentanedione CH2OH Ribulosamine CH C O HCOH HCOH homologue ATP ADP CH2OH Ribulosamine-3-P Scheme Formation and repair of ribulosamines Ribulosamines presumably result from the reaction of amines with ribose 5-phosphate, followed by enzymatic dephosphorylation of ribulosamine 5-phosphates by a phosphatase Ribulosamines are phosphorylated by fructosamine 3-kinase (FN3K) homologues, which leads to their destabilization and recovery of the unmodified amine Erythrulosamines presumably form in a similar manner from erythrose 4-phosphate (data not shown) well documented By contrast, the presence of ribulosamines in cells has not been demonstrated We have previously speculated that they may form through a reaction of amines with ribose 5-phosphate, a potent glycating agent The resulting ribulosamine 5-phosphates, however, are not substrates for FN3K-RP and they therefore need to be dephosphorylated by a phosphatase to become a substrate of FN3K-RP (Scheme 1) We recently purified a ribulosamine 5-phosphatase from human erythrocytes, a cell type in which FN3K-RP is very active, and we identified this enzyme as low-molecular-weight protein-tyrosine-phosphatase A (LMW-PTP-A) [7] As homologues of FN3K are also found in bacteria [1], where genes encoding functionally related proteins are often arranged in operons, we proceeded to analyze bacterial genomes In several instances, we found that an FN3K homologue was associated in an operon with a putative LMW-PTP These findings led us to express and characterize five bacterial FN3K homologues and three LMW-PTP homologues, and to study their substrate specificity To identify the bacterial genomes comprising an FN3K homologue, we performed tBLASTn searches in the microbial genome database available at http:// www.ncbi.nlm.nih.gov As of February 2007, 27% (210 ⁄ 760) of all available genomes, and the same proportion (124 ⁄ 453) of completely sequenced genomes, contained an FN3K homologue No more than one homologue was identified per bacterial genome Remarkably, an FN3K homologue is present in all Cyanobacteria, but only in some members of other bacterial families (supplementary Table S1) For instance, among Pasteurellaceae, Haemophilus somnus and Actinobacillus succinogenes comprise an FN3K homologue, but this is not the case for Haemophilus influenzae and Actinobacillus pleuropneumoniae An FN3K homologue was found in only of the 38 sequenced archaeal genomes, that of Haloarcula marismortui FN3K homologues were also identified in eukaryotes As previously described, two different homologues, one closer to human FN3K and the other closer to FN3K-RP, are present in mammals and birds, whereas only one homologue is observed in fish (and is closer to FN3K-RP) One single FN3K homologue is present in Caenorhabditis elegans, Caenorhabditis briggsae and Ciona intestinalis, and at least three different homologues are present in Strongylocentrotus purpuratus, but there are none in insects Homologues are also found in several fungi (e.g Aspergilli, Neurospora crassa, Magnaporthe grisea) although not in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe Among protozoa, a homologue is found in Giardia lamblia and Trypanosoma cruzi, but none in two other trypanosomatids, Trypanosoma brucei and Leishmania major The sequences were aligned by ClustalX and a neighbour-joining tree was constructed (Fig 1) Bacterial sequences formed several clusters corresponding mostly to known groups of bacteria [e.g Actinobacteria, Cyanobacteria (two clusters) and bacteria of the gamma subdivision (Enterobacteriales, Pasteurellaceae, Vibrionaceae)] Eukaryotic sequences formed one single cluster, with the exception of the FN3K homologue of T cruzi, which clustered with bacterial sequences Genome context We also examined the genome context of the bacterial FN3K homologues, as this could point to functionally FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4361 Bacterial fructosamine 3-kinase homologues R Gemayel et al Ribulosamine Associated Associated 3-kinase LMW-PTP YniC activity (distance in bp) (distance in bp) Yersinia pestis Photorhabdus luminescens Enterobacteriales Erwinia carotovora * Escherichia coli * Salmonella enterica * Pasteurella multocida Haemophilus somnus Pasteurellaceae * Mannheimia succiniciproducens Vibrio parahaemolyticus Vibrio vulnificus Vibrio cholerae Vibrionaceae Vibrio fischeri Photobacterium profundum Pseudoalteromonas haloplanktis Colwellia psychrerythraea Anabaena variabilis * Nostoc punctiforme Thermosynechococcus elongatus Crocosphaera watsonii Cyanobacteria Synechocystis sp Trichodesmium erythraeum Gloeobacter violaceus Synechococcus elongatus Nitrosomonas europaea Azoarcus sp Thiobacillus denitrificans Thiomicrospira crunogena Synechococcus sp Prochlorococcus marinus str Cyanobacteria + Prochlorococcus marinus Prochlorococcus marinus subs Microbulbifer degradans Staphylococcus aureus * Staphylococcus epidermidis * Lactobacillus casei Oenococcus oeni Lactobacillales Lactobacillus plantarum + Leuconostoc mesenteroides Trypanosoma cruzi Eukaryote Enterococcus faecium Cytophaga hutchinsonii Salinibacter ruber Gallus gallus FN3K-RP + Homo sapiens FN3K-RP Danio rerio * Homo sapiens FN3K * Gallus gallus FN3K Strongylocentrotus purpuratus Eukaryotes Caenorhabditis briggsae Aspergillus fumigatus * Neurospora crassa Arabidopsis thaliana Giardia lamblia Thermobifida fusca Nocardia farcinica Corynebacterium efficiens * Corynebacterium glutamicum Mycobacterium avium Actinobacteria Propionibacterium acnes + Nocardioides sp Bifidobacterium breve * Bifidobacterium longum Thermus thermophilus Chromohalobacter salexigens Zymomonas mobilis Rhodobacterales bacterium Rubrobacter xylanophilus Rhodospirillum rubrum Haloarcula marismortui Archaea + * + yes (1094) yes (785) yes (918) yes (724) yes (728) + no yes (0) yes (335) yes (-19) yes yes yes yes yes yes yes yes yes (0) yes (17) yes yes (12) yes (-3) yes yes (-37) yes (66) yes (-10) 0.1 Fig Fructosamine 3-kinase (FN3K) homologues: neighbour-joining tree, activity and association with putative phosphatases in various bacterial genomes The Haloarcula marismortui sequence was used as an outgroup Symbols at the nodes represent the support for each node as obtained by 1000 bootstrap samplings: (*), > 95%; (+), 80–95%; (·), 50–80% Nodes with no symbol were found in < 50% of the bootstrap samplings The branch lengths are proportional to the number of substitutions per site The horizontal bar represents 0.1 substitutions per site The first column indicates the proteins that have been shown to phosphorylate ribulosamines in this work (framed) or in previous work The last two columns indicate the presence of homologues of low-molecular-weight protein-tyrosine-phosphatase (LMW-PTP) or the phosphatase YniC close to the FN3K homologue in bacterial genomes The figure between parentheses indicates the distance (in base pairs) separating the two ORFs Negative values mean that the two sequences partially overlap related proteins and therefore provide information on the origin of the substrate(s) or on the fate of the product(s) of the FN3K homologues Except for evolutionarily related bacteria, this genome context is extremely variable However, the gene encoding the FN3K 4362 homologue is immediately preceded by a putative LMW-PTP in 11 genomes from phylogenetically distant bacteria: Cytophaga hutchinsonii, Thermus thermophilus (Fig 2), Acidothermus cellulolyticus, Fulvimarina pelagi, Gloeobacter violaceus, Microscilla marina, FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al Bacterial fructosamine 3-kinase homologues Histidine kinase LMW-PTP FN3K Hypothetical IndA protein protein Thermus thermophilus Fig Genomic environment of some bacterial fructosamine 3-kinase (FN3K) homologues.The genomic arrangements are shown for the FN3K homologues of Thermus thermophilus, Cytophaga hutchinsonii and Escherichia coli The most significant finding was the association of the FN3K homologue with a low-molecular-weight protein-tyrosine-phosphatase (LMW-PTP) homologue Alkyl hydroperoxide Fe uptake regulator LMW-PTP FN3K reductase GTP Hypothetical binding proteins protein Cytophaga hutchinsonii Outer Membrane Protein PFKb Hypothetical protein FN3K YniB YniC Hydrolase Escherichia coli Nocardioides sp., Rubrobacter xylanophilus, Salinibacter ruber, Thermobifida fusca and Zymomonas mobilis (the second column of Fig 1, and data not shown) The short distance between the two ORFs (average distance 15 nucleotides) and their identical orientation suggest that they belong to the same operon In another genome (from Rhodospirillum rubrum), the sequences encoding the LMW-PTP and FN3K homologues are separated by an ORF of  550 bp on the other strand (data not shown) blast searches with the Escherichia coli proteintyrosine kinase wzc [8] did not indicate the presence of a homologue of this enzyme in several bacteria containing the putative LMW-PTP ⁄ FN3K operon (A cellulolyticus, Nocardioides sp., S ruber, T fusca, T thermophilus and Z mobilis) This makes the presence of an LMW-PTP homologue all the more intriguing Another potentially interesting association observed in other genomes is that of the FN3K homologue with a phosphatase (YniC) belonging to the HAD family and shown to act, in E coli, on a variety of phosphate esters [9] The FN3K homologue is immediately followed by this phosphatase in the genomes of Photobacterium profundum and Mannheimia succiniciproducens and is separated from it by an ORF in the other orientation (YniB, called YfeE in Yersinia pestis, or homologues) in E coli (Fig 2), Erwinia carotovora, Salmonella enterica and various Shigella and Yersinia species (data not shown) The phosphatase YniC is, however, absent from the genomes of most Vibrionaceae (which comprise an FN3K homologue) (Fig 1), but present in other bacteria of the gamma subdivision (various Shewanella species, Marinomonas sp.) that not comprise an FN3K homologue It is therefore likely that the phosphatase YniC, contrary to LMW-PTP, is not functionally related to FN3K homologues Sequence alignments Figure shows an alignment of the five bacterial proteins that have been biochemically characterized in the present work with those of eukaryotic FN3K or FN3K-RP that have been previously studied (human FN3K and FN3K-RP; the FN3K homologue of Arabidopsis thaliana) [1,4,6,10] All sequences share several conserved motifs The most striking one is the nucleotide-binding motif (LHGDLWxGN; residues 214–222 in the human FN3K sequence), which is similar to that found in aminoglycoside kinases (LHxDLHxxN) Vertebrate FN3Ks and FN3K-RPs contain a stretch of about 20 residues (residues 118–140 in human FN3K) that is absent from the prokaryotic sequences and from the eukaryotic sequences of plants, fungi and protists In relation with the lack of activity of the E coli FN3K homologue (see below), it is interesting to point out that its sequence differs from the others at several positions that are conserved in all other sequences: Ser131 (replacing Gly); Arg142 (replacing Asp or Glu); Gln231 (replacing Phe); Arg264 (replacing His); and His272 (replacing Tyr) Action of bacterial FN3K homologues on LMW substrates Five bacterial FN3K homologues, from Enterococcus faecium, E coli, Lactobacillus plantarum, Staphylococcus aureus, and T thermophilus, which share about 30% sequence identity with the human enzyme and 30–40% sequence identity among them, were expressed in E coli They were purified to homogeneity and their kinetic properties were investigated All bacterial FN3K homologues, except for that from E coli, phosphorylated LMW ribulosamines and erythrulosamines (Table 1), but not fructosamines (data not shown) Ribulosamines and erythrulosamines bound to the FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4363 Bacterial fructosamine 3-kinase homologues R Gemayel et al Fig Alignment of human fructosamine 3-kinase (FN3K) and fructosamine 3-kinaserelated protein (FN3K-RP) with the bacterial homologues investigated in the present study The sequences were aligned using CLUSTALX Conserved residues are highlighted and the residues that differ in the Escherichia coli FN3K homologue sequence are underlined The abbreviations used are: FN3K (human FN3K), FN3KRP (human FN3K-RP), ARATH (FN3K homologue from Arabidopsis thaliana), ECOLI (Escherichia coli), ENTFAE (Enterococcus faecium), LACTPL (Lactobacillus plantarum), STAPH (Staphylococcus aureus) and THERM (Thermus thermophilus) epsilon-amino group of lysine or to cadaverine (decarboxylated lysine) were substrates for these enzymes, whereas the ribulosamines bound to the alpha-amino groups of glycine, leucine and valine were not (data not shown) Erythrulosamines were better substrates than ribulosamines as indicated by the 6–20-fold higher catalytic efficiencies observed with erythruloselysine than with ribuloselysine d-ribulose, d-erythrulose and reduced ribuloselysine (pentitollysine), all tested at mm, were not phosphorylated by the L plantarum FN3K homologue To check the position of the phosphorylated carbon, ribuloselysine was phosphorylated by the S aureus FN3K homologue, and the phosphorylation product 4364 was purified and analysed by tandem mass spectrometry, as previously described [6] The same fragmentation spectrum was observed [6] In particular, fragments of m ⁄ z 349 and 319 were found, which indicated that the third carbon of the sugar moiety was phosphorylated The E coli FN3K homologue was inactive on all the above-mentioned compounds, including ribuloselysine and erythruloselysine It was also inactive on more than 50 other potential phosphate acceptors, including d-ribulose, d-xylulose, choline, ethanolamine, l-serine, hydroxypyruvate, d-glycerate, thiamine and dl-homoserine (tested at concentrations of 0.1–5 mm) FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al Bacterial fructosamine 3-kinase homologues Action of bacterial FN3K homologues on protein-bound ketoamines 0.20 FN3K 0.15 S aureus 0.10 E faecium M musculus L plantarum 0.05 T thermophilus - 0.00 10 15 20 25 Time (min) B Incorporated Phosphate (mol P/mol ribulosamines) We also tested the ability of the bacterial FN3K homologues to phosphorylate protein-bound ribulosamines Two proteins, hen egg lysozyme and E coli thioredoxin A, were glycated with ribose and used as substrates (Fig 4) All four active bacterial FN3K homologues and mouse FN3K catalysed the phosphorylation of protein-bound ribulosamines, although their relative activity was dependent on the substrate used With glycated lysozyme, the most active enzyme was the S aureus FN3K homologue, and the least active enzyme was the one from T thermophilus Glycated thioredoxin A was best phosphorylated by mouse FN3K, which apparently had access to more glycation sites than its bacterial homologues The initial rate of the reaction with lysozyme-bound ribulosamines was a hyperbolic function of the substrate concentration in the case of the S aureus enzyme, for which Km and Vmax values could therefore be determined (Table 1) The other enzymes were not saturated at the highest concentration of lysozymebound ribulosamines that we tested (500 lm) and their activities at a substrate concentration of 100 lm are presented in Table Protein-bound ribulosamines were poorer substrates than free ribuloselysine: from the kinetic data, it can be calculated that the activity on lysozyme-bound ribulosamines amounted to  10% of the activity observed with free ribuloselysine at the same concentration Lysozyme-bound erythrulosamines were also phosphorylated by the four active bacterial FN3K homologues at rates that were about twofold higher Incorporated Phosphate (mol P/mol ribulosamines) A FN3K 0.15 M musculus 0.10 T thermophilus S aureus L plantarum E faecium 0.05 - 0.00 10 15 20 25 Time (min) Fig Phosphorylation of protein-bound ribulosamines by mouse fructosamine 3-kinase (FN3K) and four bacterial FN3K homologues Lysozyme (A) and Escherichia coli thioredoxin A (B) glycated with ribose were used as substrates at 50 lM protein-bound ribulosamines The samples were incubated with [32P]ATP[cP] and 50 lgỈmL)1 of each FN3K homologue Incorporated phosphate was measured at different time-points The results are the means of three independent measurements ± SEM (E faecium), or two- to fourfold lower (all others), than those observed with lysozyme-bound ribulosamines Lysozyme-bound fructosamines were not detectably Table Kinetic properties of the bacterial fructosamine 3-kinase (FN3K) homologues The results are the means of two or three determinations In the latter case, the SEM value is given Vmax values are expressed as nmol phosphorylated product formed per and per mg of protein E faecium, Enterococcus faecium; L plantarum, Lactobacillus plantarum; ND, not determined; S aureus, Staphylococcus aureus; T thermophilus, Thermus thermophilus L plantarum Substrate Km (lM) Vmax Km (nmolỈmin)1Ỉmg)1) (lM) Ribuloselysine 300 510 Ribulosecadaverine 340 2860 Erythruloselysine 60 610 Erythrulosecadaverine 63 800 Ribulosamine> 500 16 ± 0.3a lysozyme Ribulosamine> 500 59 ± 6a Thioredoxin A Erythrulosamine> 500 3.8 ± 0.1a lysozyme a E faecium 185 44 15 34 > 500 S aureus Vmax Km (nmolỈmin)1Ỉmg)1) (lM) 730 1340 480 460 40 ± 4a 580 ± 40 > 500 T thermophilus Vmax Km (nmolỈmin)1Ỉmg)1) (lM) 58 1300 NDa ND 13 1930 ND ND 44 ± 220 ± 25 52 ± 460 80 ± 6a 42 ± 250 78 ± Vmax (nmolỈmin)1Ỉmg)1) 58 450 ND ND 770 ND ND > 500 ± 1a 270 130 > 500 4.2 ± 0.2a Activity at 100 lM protein-bound ribulosamine or erythrulosamine FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4365 Bacterial fructosamine 3-kinase homologues R Gemayel et al phosphorylated by the enzymes from E faecium and L plantarum, but they were slowly phosphorylated by the enzymes from S aureus and T thermophilus, at rates corresponding to 0.4 and 2%, respectively, of the activity observed with lysozyme-bound ribulosamines None of these enzymes catalysed the phosphorylation of protein-bound ribulosamine 5-phosphates (data not shown) The E coli FN3K homologue was also inactive on all macromolecular substrates tested, which included lysozyme-bound d- and l-ribulosamines, d-ribulosamine 5-phosphates, fructosamines and erythrulosamines (data not shown) The product of the phosphorylation of lysozymebound ribulosamines by the FN3K homologues from S aureus and T thermophilus broke down with a halflife of 26–28 at 37 °C and neutral pH (data not shown), as previously observed with the product of human FN3K-RP [5] and the plant FN3K homologue [6] These results further indicated that bacterial FN3K homologues also phosphorylated carbon of the sugar moiety of ribulosamines Substrate specificity of the LMW-PTP homologues We expressed the LMW-PTP homologue belonging to the same operon as the FN3K homologue in the T thermophilus genome, as well as the two LMW-PTP homologues, PtpA and PtpB [11], present in the S aureus genome PtpA and PtpB, which share, respectively, 38 and 28% sequence identity with T thermophilus LMWPTP, are encoded by genes that are distant from the gene encoding the FN3K homologue and not apparently belong to operons All three recombinant proteins were purified to homogeneity and their activities tested both on LMW and macromolecular substrates S aureus PtpB was poorly active or inactive on all substrates tested, in agreement with previous results [11] The other two enzymes dephosphorylated previously described substrates for LMW-PTP (p-nitrophenyl phosphate, FMN), but also ribuloselysine 5-phosphate and erythruloselysine 4-phosphate, the T thermophilus enzyme being particularly active on the latter substrate (Table 2) They did not act on ribose 5-phosphate, fructose 6-phosphate or glucose 6-phosphate (data not shown) We checked that dephosphorylation of ribuloselysine 5-phosphate by S aureus LMW-PTP (PtpA) led to the formation of a substrate for a bacterial FN3K homologue (the one from E faecium was used in this experiment) That the resulting phosphorylation product was ribuloselysine 3-phosphate was indicated by its instability and by the fact that its decomposition led to the appearance of 4366 Table Activities of low-molecular-weight protein-tyrosine-phosphatase (LMW-PTP) homologues on LMW substrates Substrates were assayed at 0.5 mM final concentration Activities are expressed as nmol inorganic phosphate formed per and per mg of protein The data represent the means of three values ± SEM ND, not detectable; Ptp, LMW-PTP of S aureus; S aureus, Staphylococcus aureus; T thermophilus, Thermus thermophilus Enzyme activity (nmolỈmin)1Ỉmg of protein) Substrate S aureus T thermophilus (PtpA) p-Nitrophenyl phosphate 1820 ± 140 Flavin mononucleotide 1730 ± 130 Ribuloselysine127 ± 5-phosphate Erythruloselysine5300 ± 630 4-phosphate S aureus (PtpB) 7750 ± 230 42 ± 16900 ± 520 24 ± 810 ± 80 ND 1470 ± 100 ND 4,5-dihydroxy-1,2-pentanedione, as determined by mass spectrometry analysis of the quinoxaline derivative [6] The activity of LMW-PTPs on protein substrates was tested through the release of 32P from radiolabelled substrates As shown in Fig 5, T thermophilus LMW-PTP acted about 10-fold faster on protein tyrosine-phosphates than on protein ribulosamine 5-phosphates, whereas S aureus PtpA acted preferentially on the latter substrate S aureus PtpB was also poorly active on protein substrates As illustrated for T thermophilus LMWPTP, dephosphorylation of lysozyme glycated with ribose 5-phosphate by this phosphatase led to the formation of a substrate for the S aureus FN3K homologue (Fig 6) The resulting phosphorylation product was unstable and broke down, at 37 °C, with a half-life similar to that of ribulosamine 3-phosphates (data not shown) Similarly, incubation of lysozyme-bound erythrulosamine 4-phosphates with T thermophilus LMW-PTP or S aureus PtpA led to the formation of a substrate for the S aureus FN3K homologue (Fig 7) Discussion Most bacterial FN3K homologues are ribulosamine ⁄ erythrulosamine 3-kinases Four of the five bacterial FN3K homologues that we studied are ribulosamine ⁄ erythrulosamine 3-kinases This property is shared by mammalian and avian FN3Ks and FN3K-RPs, as well as by the single FN3K homologue present in fish and plants This observation leads us to the conclusion that the ancestral ‘FN3K’ protein was probably a ribulosamine ⁄ erythrulosamine 3-kinase The ability to phosphorylate FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al Bacterial fructosamine 3-kinase homologues Enzyme -1 50 µg.mL µg.mL-1 100 90 80 70 60 50 40 30 20 10 0 20 40 60 80 100 120 Substrate Lysozyme-RN5P MBP-TyrP Lysozyme-RN5P MBP-TyrP 140 Time (min) B 80 Enzyme 70 Release of 32P (%) Fig Dephosphorylation of protein tyrosine-phosphates and protein ribulosamine 5-phosphates by bacterial LMW-PTP homologues Thermus thermophilus (A) and Staphylococcus aureus (B) low-molecularweight protein-tyrosine-phosphatase (LMW-PTP) homologues were used to dephosphorylate myelin basic protein-bound [32P]tyrosine phosphates (MBP-TyrP) and lysozyme-bound [32P]ribulosamine 5-phosphates (Lysozyme-RN5P), both tested at lM protein-bound [32P]phosphate The concentration of each homologue used is shown on the graph, and conditions where no LMW-PTP was added are shown in open symbols The radioactivity, corresponding to 32 P inorganic phosphate, released after trichloroacetic acid precipitation of proteins was measured at different time-points The results are the means of three independent measurements ± SEM Release of 32P (%) A Substrate -1 PtpA 10 µg.mL Lysozyme-RN5P 60 50 PtpA 10 µg.mL-1 MBP-TyrP 40 30 PtpB 50 µg.mL-1 Lysozyme-RN5P 20 PtpB 50 µg.mL-1 MBP-TyrP 10 0 fructosamines, which is restricted to mammalian and avian FN3Ks, was acquired late in evolution following a gene duplication event that took place in the lineage leading to mammals and birds [10] It is not known at present if the E coli homologue is an inactive protein or if it has acquired a distinct substrate specificity The physiological substrate of the active bacterial FN3K homologues is presently not known, but its structure is presumably close to that of a ribulosamine or an erythrulosamine The observations that no phosphorylation is observed with ribulose, with the reduced forms of ribuloselysine and with xyluloselysine (C3 epimer of ribuloselysine), stress the importance of the presence of an amino group on C1, a keto function on C2 and a hydroxyl group with a D configuration on C3 In addition, as initially observed with FN3K [12], ketoamine derivatives bound to the alpha amino group of amino acids are poor substrates, whereas ketoamines bound to the epsilon amino group of lysine or cadaverine are excellent substrates Bacterial FN3K homologues are more than 10-fold more active on LMW ketoamines than on proteinbound ketoamines, which suggests that their physiological substrates are LMW compounds However, their absolute activity on protein substrates is higher than 10 15 20 25 30 35 Time (min) that of mammalian FN3K or FN3K-RP on similar substrates For instance, the Vmax of fructosamine 3-kinase when it acts on lysozyme-bound fructosamines amounts to  10 nmolỈmin)1Ỉmg)1 of protein (G Delpierre, E Van Schaftingen, unpublished results), which is about 20-fold lower than the Vmax of the S aureus enzyme for protein-bound ribulosamines As FN3K and FN3K-RP have been shown to be involved in protein repair in vivo or in intact cells [2,3,5], this comparison suggests that this may also be true for their bacterial homologues Endogenous or exogenous source for the substrates of bacterial FN3K homologues? The specificity of the FN3K homologues indicates that they act on sugar derivatives The latter could either be of internal or external origin The absence of association of FN3K homologues with a transporter does not support the idea that they play a role in the metabolism of an exogenous substrate This is unlike fructosamine-6-phosphate deglycases, which are almost always encoded by operons also containing genes for putative fructosamine transporters [13,14] It is also conceivable that the substrate for the FN3K FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4367 Bacterial fructosamine 3-kinase homologues R Gemayel et al Liberated Inorganic Phosphate (mol P/mol lysozyme) A LMW-PTP 0.5 Ribose-5-P T thermophilus 20 mM 0.4 0.3 0.2 0.1 20 mM mM T thermophilus 100 0.0 20 40 60 80 Time (min) Incorporated Phosphate (mol P/mol lysozyme) B LMW-PTP 0.05 Ribose-5-P T thermophilus 20 mM T thermophilus 20 mM mM 0.04 0.03 0.02 0.01 0.00 20 40 60 80 100 Time(min) Fig Dephosphorylation of protein ribulosamine 5-phosphates by the Thermus thermophilus low-molecular-weight proteintyrosine-phosphatase (LMW-PTP) homologue and rephosphorylation by a bacterial fructosamine 3-kinase (FN3K) homologue (A) Lysozyme (5 mgỈmL)1) glycated with 20 mM ribose 5-phosphate was incubated with 60 lgỈmL)1 of T thermophilus LMWPTP (closed circles), or without LMW-PTP (open circles) Unglycated lysozyme was also incubated with T thermophilus LMWPTP (closed diamonds) The liberated inorganic phosphate was measured at different time-points (B) The resulting product of dephosphorylation was then incubated with [32P]ATP[cP] and 50 lgỈmL)1 of Staphylococcus aureus FN3K homologue for 15 and the incorporated phosphate was measured The results are the means of three independent measurements ± SEM Liberated Inorganic Phosphate (mol P/mol lysozyme) A 0.5 LMW-PTP 0.4 T thermophilus 10 mM 0.3 S aureus PtpA 10 mM T thermophilus mM 0.2 S aureus PtpA 0.1 - 0.0 10 15 20 Erythrose-4-P mM 10 mM mM 25 Time(min) B Incorporated Phosphate (mol P/mol lysozyme) 0.12 LMW-PTP 0.10 T thermophilus 10 mM T thermophilus mM S aureus PtpA S aureus PtpA 10 mM mM - 10 mM mM 0.08 0.06 0.04 0.02 0.00 10 15 Time(min) 4368 Erythrose-4-P 20 25 Fig Dephosphorylation of protein erythrulosamine 4-phosphates by bacterial low-molecular-weight protein-tyrosinephosphatase (LMW-PTP) homologues and rephosphorylation by a bacterial fructosamine 3-kinase (FN3K) homologue (A) Lysozyme (5 mgỈmL)1) glycated with or 10 mm erythrose 4-phosphate was incubated with 20 lgỈmL)1 of Thermus thermophilus LMW-PTP (open squares and triangles) or Staphylococcus aureus proteintyrosine-phosphatase A (closed squares and triangles) or without LMW-PTP (open circles and diamonds) Unglycated lysozyme was also incubated with T thermophilus LMWPTP (closed circles) The liberated inorganic phosphate was measured at different time-points (B) The resulting product of dephosphorylation was then incubated with [32P]ATP[cP] and 50 lgỈmL)1 of S aureus FN3K for and the incorporated phosphate was measured The results are the means of three independent measurements ± SEM FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al homologues is an exogenous, toxic compound, which, like aminoglycosides and macrolides, would have to be inactivated by phosphorylation [15] To the best of our knowledge, no known antibiotic is a ketoamine derivative, but hypothetical ketoamine antibiotics may have been missed in the screenings for antibacterial compounds because of their instability An endogenous origin for the substrate(s) of FN3K homologues has therefore to be considered However, except for the association with an LMW-PTP (see below), the context in which FN3K homologues are found in bacterial genomes is not suggestive of any pathway leading to the formation of a ketoamine Bacterial fructosamine 3-kinase homologues We considered the possibility that the FN3K homologues which we studied could be tyrosine kinases However, no phosphorylation was observed when these enzymes were allowed to act upon proteins that had not been glycated with ribose or erythrose (data not shown) Interestingly, LMW-PTP did not display detectable ribulosamine 3-phosphate phosphatase activity, which indicates that its function is not to antagonize the activity of the FN3K homologues, but, on the contrary, to complement it The most probable hypothesis is therefore that the phosphatase functions physiologically as a ribulosamine 5-phosphate ⁄ erythrulosamine 4-phosphate phosphatase, allowing the formation of substrates for the FN3K homologues The association with a phosphatase suggests that ribulosamines are formed from ribulosamine 5-phosphates Potential sources of ribulosamine 5-phosphates and erythrulosamine 4-phosphates We have previously speculated that ketoamines may arise through glycation of amino compounds by ribose 5-phosphate or erythrose 4-phosphate, which are potent glycating agents that occur physiologically in all cell types The ribulosamine 5-phosphates and erythrulosamine 4-phosphates that are so formed are not substrates for mammalian or bacterial FN3K homologues A phosphatase is therefore needed to remove the terminal phosphate before these kinases can act (Scheme 1) We recently purified a ribulosamine 5-phosphatase from human erythrocytes and identified it as LMW-PTP-A [7] Interestingly, an LMW-PTP homologue forms an operon with the FN3K homologue in 11 genomes from phylogenetically distant bacteria This association was not the result of recent lateral transfer events, as indicated by the fact that the homologues of FN3K and LMW-PTP present in these operons are very distant proteins This operon is therefore either an extremely ancient operon that has been conserved or the result of distinct recombination events that took place independently in several bacterial lineages Both explanations argue strongly for the physiological relevance of this association The LMW-PTP homologue of T thermophilus, and one of the two homologues (PtpA) of S aureus, dephosphorylated not only phosphotyrosine, but also ribulosamine 5-phosphates and erythrulosamine 4-phosphates, converting them to substrates for bacterial FN3K homologues The apparent absence of a bacterial-type tyrosine kinase in several of the bacterial genomes containing the putative LMW-PTP ⁄ FN3K operon suggests that the LMW-PTP homologues may serve physiologically to dephosphorylate substrates different from protein-tyrosine phosphates Ribose 5-phosphate and erythrose 4-phosphate are potent glycating agents, reacting with proteins about 80- and 500-fold more rapidly than glucose, respectively [7,16; R Gemayel, unpublished results] The information on the concentration of these phosphate esters in bacteria is scant The xylulose 5-phosphate content of Oenococcus oeni (previously known as Leuconostoc oenos) amounts to 0.1–0.33 lmolỈg)1 dry weight, corresponding to concentrations of about 0.033–0.1 mm [17] The concentration of ribose 5-phosphate is probably of the same order of magnitude, indicating that in this bacterium, the glycating power of ribose 5-phosphate is comparable to that of mm glucose Erythrose 4-phosphate is likely to accumulate in bacteria under some conditions, for example in the absence of O2 in O oeni This bacterium forms substantial amounts of erythritol under this condition, because phosphoketolase acts then on fructose 6-phosphate rather than on xylulose 5-phosphate and therefore forms erythrose 4-phosphate (and acetylphosphate) [17] Although we have no proof at this stage that FN3K and LMW-PTP homologues participate in the repair of glycation adducts made from ribose 5-phosphate and erythrose 4-phosphate, indirect arguments support this hypothesis One is the consistent presence of FN3K and LMW-PTP homologues (Table S1) in Cyanobacteria, which are dependent on the Calvin cycle This is reminiscent of the high ribulosamine 3-kinase activity found in spinach leaves and the fact that plant FN3K homologues are targeted to chloroplasts [6] Furthermore, the glycation repair hypothesis may offer a unitary explanation for the presence of enzymes with a similar function in organisms or cells that are so dissimilar as bacteria, plants and erythrocytes Unlike FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4369 Bacterial fructosamine 3-kinase homologues R Gemayel et al bacteria and plant cells, which have tremendous metabolic capacities, mammalian erythrocytes are particularly poor in enzymes of intermediary metabolism, their function being focused on O2 transport and haemoglobin maintenance Yet, in all cases, glycation by ribose 5-phosphate and erythrose 4-phosphate is likely to be operative The limitation of this last argument is, however, that FN3K homologues may actually play different roles in different organisms An objection that can be raised against the role of FN3K homologues in deglycation is that an LMWPTP is not found in several of the genomes that contain them However, this may be because the enzymatic activity is carried out by another type of phosphatase Another objection is that protein repair does not make sense for such rapidly dividing organisms as bacteria However, two other protein-repair mechanisms – those catalysed by protein-l-isoaspartate-O-methyltransferase [18] and methionyl sulphoxide reductases [19] – operate in prokaryotes Finally, as ribose 5-phosphate and erythrose 4-phosphate are ubiquitous, why are FN3K homologues only found in some organisms? This question may receive multiple answers, such as (a) other proteins – not necessarily kinases – could carry out deglycation in organisms devoid of FN3K homologues, (b) the levels of ribose 5-phosphate and erythrose 4-phosphate could be lower in these bacteria than in those containing an FN3K homologue and (c) there could be bacteria in which no process is sensitive to glycation Whatever the real physiological function of bacterial FN3K homologues, the demonstration that they act as ribulosamine ⁄ erythrulosamine 3-kinases will be helpful in further studies on protein deglycation by offering tools that can be easily produced (unlike mammalian FN3K-RPs) [4] in substantial amounts to study this process Thus, these enzymes could be useful to detect protein-bound ribulosamines and erythrulosamines by tagging them with radiolabelled ATP This could provide a demonstration for the presence of these protein modifications under physiological and pathological conditions and an avenue for the identification of proteins that have this type of modification, be it linked or not to glycation Experimental procedures Materials Reagents, of analytical grade whenever possible, were from Sigma (St Louis, MO, USA), Acros (Geel, Belgium), Merck (Darmstadt, Germany), MP-Biomedicals (Irvine, CA, USA) or Roche (Mannheim, Germany) HisTrap, PD-10, NAP-5 4370 columns, sulfopropyl (SP)-Sepharose, diethylaminoethyl (DEAE)-Sepharose, Sephacryl S-200, and [32P]ATP[cP] were from GE Healthcare (Diegem, Belgium) Vivaspin-15 centrifugal concentrators were from Vivascience (Gottingen, ă Germany) Biogel P2 was purchased from Bio-Rad (Hercules, CA, USA) and Dowex 1-X8 (100–200 mesh) was purchased from Acros N-a-t-Boc-lysine was from Novabiochem (Merck) Restriction enzymes were purchased from Roche or Fermentas (St Leon-Rot, Germany) Mouse recombinant FN3K was prepared as previously described [1] Preparation of ketoamines Synthesis of glycated proteins Lysozyme glycated with ribose was prepared as previously described [4], except that the buffer used was Mes, pH 6, and the degree of glycation was 2.8 mol of ribulosamine per mol of lysozyme Lysozyme glycated with l-arabinose (which gives rise to l-ribulosamines) was prepared as described for ribose Lysozyme glycated with glucose or erythrose was prepared as previously described [6] E coli thioredoxin A glycated with ribose was prepared as follows: 20 mgỈmL)1 of purified recombinant thioredoxin A, prepared as described previously for thioredoxin [20], was incubated at 60 °C for 16 h in a solution containing 20 mm Mes, pH 6, mm EGTA and 100 mm ribose The sample was then purified by gel filtration on a NAP-5 column equilibrated with water The degree of glycation was 1.1 mol of ribulosamine per mol of thioredoxin A Lysozyme glycated with ribose 5-phosphate was prepared as described previously [7] The same procedure was used to prepare lysozyme glycated with erythrose 4-phosphate, except that erythrose 4-phosphate was used at and 10 mm and the incubation temperature was 37 °C Lysozyme glycated with 32P-ribose 5-phosphate and 32P-protein tyrosine phosphate were prepared as described previously [7,21], except that the medium contained Tris instead of Hepes Synthesis of LMW substrates Ribuloselysine, erythruloselysine, [14C]ribuloselysine and a-glycated amino acids were synthesized as described previously [6] Xyluloselysine was synthesized as described for ribuloselysine and fructoselysine was synthesized as previously described [2] Pentitollysine was prepared by incubating (in 0.1 mL) 50 mm ribuloselysine with 0.5 m NaBH4 at °C for 16 h after which 10 lL of 60% perchloric acid was added to destroy the remaining borohydride The sample was then purified by gel filtration on Biogel P2 Ribulosecadaverine was synthesized as described for ribuloselysine [6] with the following modifications: cadaverine (120 lmol) and ribose (240 lmol) were incubated at 65 °C for 16 h in mL of methanol The product was then purified by cation exchange chromatography (SP-Sepharose) and gel-filtration (Biogel P2) [2] The yield with respect to FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al ribose was  5% Using a similar protocol, erythrulosecadaverine was synthesized at 50 °C from cadaverine (240 lmol) and erythrose (60 lmol) The yield with respect to erythrose was  6% The titers were determined by end-point assays using L plantarum and E faecium FN3K homologues and [32P]ATP[cP], as previously described for ribuloselysine [6] They corresponded to 75% (ribulosecadaverine) and 25% (erythrulosecadaverine) of the values obtained by assaying the reducing power [22] Ribuloselysine 5-phosphate was prepared as previously described [7] Erythruloselysine 4-phosphate was synthesized as for ribuloselysine 5-phosphate, but with 50 mm erythrose 4-phosphate and at 37 °C Cloning and expression of the FN3K and LMW-PTP bacterial homologues Expression vectors for the bacterial FN3K and LMW-PTP homologues were constructed by PCR amplification of the corresponding coding sequences using the appropriate genomic DNA and primers (Table 3) The PCR products were digested with the appropriate restriction enzymes and inserted into pET-15b [which yields an N-terminal poly(His)-tagged protein] or pET-3a vectors and the sequences were verified These expression vectors were used to transform E coli cells (Table 3) [23] Expression of the recombinant proteins was carried out as described previously [24] under the general conditions (medium, time and temperature) indicated in Table The bacterial extracts were prepared as previously described [25] with the exception that phenylmethanesulfonyl fluoride was omitted from the extraction buffer Purification of the bacterial FN3K and LMW-PTP homologues All recombinant enzymes were purified from 50-mL extracts prepared from 1-L cultures, unless stated otherwise Protein concentration was determined by the absorbance at 280 nm, taking into consideration the theoretical extinction coefficient of each homologue, or by the Bradford method [26] in the case of the T thermophilus FN3K homologue All purified proteins were analysed by SDS ⁄ PAGE, supplemented with 10% (w ⁄ v) glycerol, and stored at )70 °C L plantarum and S aureus ‘FN3K’ Both His-tagged proteins were purified on HisTrap columns (Ni2+ form), as previously described [27], except that buffer A (25 mm Hepes, pH 7.4, lgỈmL)1 of leupeptin, lgỈmL)1 of antipain and 300 mm NaCl) was used The proteins, eluted with 300 mm (L plantarum) or 150 mm (S aureus) imidazole, were concentrated (using Vivaspin15) and desalted on PD-10 columns equilibrated with 25 mm Hepes, pH 7.4, mm dithiothreitol and 100 mm Bacterial fructosamine 3-kinase homologues NaCl (L plantarum) or 25 mm Hepes pH 7.1 (S aureus) The amount of purified protein obtained was  mg (L plantarum) and  60 mg (S aureus) E faecium ‘FN3K’ The extract was diluted twice in buffer B (25 mm Hepes pH 7.4, lgỈmL)1 of leupeptin, lgỈmL)1 of antipain and mm dithiothreitol) and then applied to a 25-cm3 DEAESepharose column equilibrated with the same buffer The column was washed with 100 mL of buffer B and proteins were eluted with a 150-mL NaCl gradient (0–0.75 m in buffer B) Fractions containing the recombinant protein were pooled, concentrated to mL (in a 10-mL Amicon cell equipped with a YM-10 membrane) and applied to a 100-cm3 Sephacryl S-200 column equilibrated with buffer B containing 100 mm NaCl The amount of purified protein was  18 mg T thermophilus ‘FN3K’ The extract was heated at 80 °C for min, left on ice for 10 and then centrifuged for 30 at 10 000 g The resulting supernatant was diluted twice in buffer B and purified on DEAE-Sepharose as for the E faecium FN3K homologue The amount of purified protein was  mg E coli ‘FN3K’ The bacterial extract (25 mL) from a 500-mL culture was brought to 20% (w ⁄ v) poly(ethylene glycol) 6000, and centrifuged for 30 at 10 000 g The resulting supernatant was diluted three-fold with buffer B and purified on DEAE-Sepharose, as described for the E faecium FN3K homologue The amount of purified protein obtained from the 500-mL culture was 54 mg T thermophilus LMW-PTP The extract was heated at 80 °C for min, left on ice for 10 and then centrifuged for 30 at 10 000 g The resulting supernatant was purified on DEAE-Sepharose, as described for the E faecium FN3K homologue, but using buffer C (25 mm Tris pH 7.1, mm dithiothreitol, lgỈmL)1 of leupeptin and lgỈmL)1 of antipain) Fractions containing T thermophilus LMW-PTP were pooled, concentrated to mL (in a 10-mL Amicon cell equipped with a YM-10 membrane) and applied to a 100-cm3 Sephacryl S-200 column equilibrated with buffer C containing 100 mm NaCl The amount of purified protein was  2.4 mg S aureus PtpA and PtpB The bacterial extracts (25 mL) from 500-mL cultures were diluted three-fold in buffer C and purified on FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4371 4372 Thermus thermophilus Staphylococcus aureus PtpB LMW-PTP homologues Staphylococcus aureus PtpA Escherichia coli Thermus thermophilus Staphylococcus aureus Enterococcus faecium FN3K homologues Lactobacillus plantarum GCAGCGCATATGGTAGATGTAGCATTTGTCTG GGCAGCGGATCCTACCCCTCTTTCAAATTTGCATC GCAGCGCATATGAAGATTCTATTCGTTTGTACAG GGCAGCGGATCCTAGCAAATAATATCTTTTAATTTTAAAA GCAGCGCATATGGACCGGCCCGTGCGCGT GGCAGCAGATCTCAAGCCCGGCCTTCCGCAG GTTCATATGCACTTAACAAAAACTTGG GAGGGATCCATTAATATTGCATGAGAATTC AACATATGGATATCCAAACTGTTTTATC GCGGATCCCTTAAAAATTTTCTAGTAATTG TTCATATGAATGAACAATGGTTAGAG CGGATCCACTAACTTGTTGTACCTTGT GCAGCGCATATGGATCCCCTAGCCCTGCTG GGCAGCAGATCTAAGAGGCGGAAATCGCCCTC GCATATGTGGCAGGCAATCAGTCGTC CGGATCCTCATGCTGCTAATAATCTATCCAATG Forward (5¢)3¢) Reverse (5¢)3¢) Primers NdeI BamHI NdeI BamHI NdeI BglII NdeI BamHI NdeI BamHI NdeI BamHI NdeI BglII NdeI BamHI Restriction enzymes BL21(DE3) BL21(DE3) pLysS BL21(DE3) Escherichia coli strain pET3a pET3a pET3a BL21-CodonPlus (DE3) BL21(DE3)plysS BL21(DE3)plysS pET3a pET3a BL21-CodonPlus (DE3) BL21(DE3)plysS pET15b pET3a pET15b Vector LB LB LB M9 (AA)b LB LB LB LBa Medium Ap Cm Ap Cm Ap Cm Ap Cm Ap Cm Ap Apc Cmd Ap Antibiotic 16 h 16 h Time 37 °C 16 h 16 h 4h 18 °C 16 h 6h 18 °C 18 °C 16 h 18 °C 18 °C Temp Table Primers used for PCR amplification and expression conditions for the recombinant fructosamine 3-kinase (FN3K) and low-molecular-weight protein-tyrosine-phosphatase (LMWPTP) homologues Restriction sites are written in italics ATG and stop codons are underlined Ap, ampicillin; Cm, chloramphenicol; LB, Luria–Bertani; M9(AA), M9 medium supplemented with mM MgSO4, 10 mM glucose, 0.5 mgỈL)1 of biotin, 0.5 mgỈL)1 of thiamin, and gỈL)1 of Casamino acids; Ptp, low-molecular-weight protein-tyrosine-phosphatase of Staphylococcus aureus; Temp., temperature 18 °C 37 °C Bacterial fructosamine 3-kinase homologues R Gemayel et al FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS R Gemayel et al DEAE-Sepharose and Sephacryl S-200 as described for the T thermophilus LMW-PTP homologue The amount of purified protein obtained from the 500-mL cultures was  13 mg for PtpA and PtpB Measurement of enzymatic activities Phosphorylation of protein-bound ketoamines was performed at 30 °C in a medium (0.1 mL) containing 25 mm Hepes pH 7.1, mm MgCl2, mm EGTA, 50 lm ATP, 106 cpm [32P]ATP[cP] and the indicated concentrations of protein-bound ketoamines and FN3K homologue The incorporation of 32P into proteins was measured as described previously [1] Phosphorylation of ribuloselysine (using [14C]ribuloselysine) and of unlabelled compounds (using [32P]ATP[cP]) was assayed as described previously [6], in the same medium as described above Phosphorylation of alpha-glycated amino acids was assayed spectrophotometrically by measuring the release of ADP through the pyruvate kinase ⁄ lactate dehydrogenase coupled assay [13] Phosphatase activities were assayed at 37 °C in a medium containing 25 mm Tris, pH 7.1, mm dithiothreitol, mm EGTA, 10 mm KCl (for T thermophilus LMW-PTP) or 100 mm K acetate (for S aureus LMW-PTPs) Dephosphorylation of [32P]protein-bound tyrosine phosphates and ribulosamine 5-phosphates was assayed as described previously [21] Activities on LMW substrates were assayed through the formation of inorganic phosphate [28] in a medium supplemented with 50 lgỈmL)1 of lysozyme Phosphorylation by S aureus FN3K homologue of the dephosphorylation products of LMW-PTP homologues Lysozyme glycated with ribose 5-phosphate or erythrose 4-phosphate (5 mgỈmL)1 or 0.36 mm lysozyme) was incubated at 37 °C with the indicated concentrations of LMWPTP homologues At the indicated time-points, aliquots (15 lL) were either rapidly frozen in liquid nitrogen or added to 100 lL of 10 mm HCl to assay inorganic phosphate [28] The frozen aliquots were then diluted twice in the FN3K incubation medium and phosphorylated with the S aureus FN3K homologue for the indicated times (see above) Database searches, sequence alignment and tree construction The NCBI nucleotide sequence database for sequenced microbial genomes was used to search for homologues of human FN3K using tBLASTn and the protein database was also searched using PSI-BLAST [29] Only the sequences with a score of > 50 were considered as FN3K homologues This criterion permitted the inclusion only of sequences belonging to COG3001 (i.e of the FN3K family) and the exclusion Bacterial fructosamine 3-kinase homologues of sequences that are closer to other kinases (e.g choline ⁄ ethanolamine kinase, methylthioribose kinase, aminoglycoside kinases) than to FN3K The sequences were aligned using ClustalX with the default parameters [30] A neighbour-joining tree was constructed using the ‘tree’ option of the ClustalX program after exclusion of positions with gaps and with correction for multiple substitutions For the bootstrap analysis, 1000 samplings were carried out Acknowledgements This work was supported by grants from the Juvenile Diabetes Foundation International, the Interuniversity Attraction Poles Program-Belgian Science Policy (Networks P6 ⁄ 05 and P6 ⁄ 28), and the Concerted Research Action Program of the French Community of Belgium ` RG is fellow of the Fonds pour l’Encouragement a la Recherche dans l’Industrie et dans l’Agriculture ´ MVDC is chercheur qualifie of the Fonds National de la Recherche Scientifique L plantarum genomic DNA ´ was kindly provided by P Hols (Universite Catholique de Louvain), E faecium genomic DNA by P Charlier ´ ` (Universite de Liege), S aureus genomic DNA by J Van Eldere (Katholieke Universiteit Leuven), and T thermophilus genomic DNA by J.-F Collet ´ (Universite Catholique de Louvain) References Delpierre G, Rider MH, Collard F, Stroobant V, Vanstapel F, Santos H & Van Schaftingen E (2000) Identification, cloning, and heterologous expression of a mammalian fructosamine 3-kinase Diabetes 49, 1627–1634 Delpierre G, Collard F, Fortpied J & Van Schaftingen E (2002) Fructosamine-3-kinase is involved in an intracellular deglycation pathway Biochem J 365, 801–808 Veiga-da-Cunha M, Jacquemin P, Delpierre G, Godfra´ ind C, Theate I, Vertommen D, Clotman F, Lemaigre F, Devuyst O & Van Schaftingen E (2006) Increased protein glycation in fructosamine 3-kinase-deficient mice Biochem J 399, 257–264 Collard F, Delpierre G, Stroobant V, Matthijs G & Van Schaftingen E (2003) A mammalian protein homologous to fructosamine-3-kinase is a ketosamine-3kinase acting on psicosamines and ribulosamines but not on fructosamines Diabetes 12, 2888–2895 Collard F, Wiame E, Bergans N, Fortpied J, Vertommen D, Vanstapel F, Delpierre G & Van Schaftingen E (2004) Fructosamine 3-kinase-related protein and deglycation in intact erythrocytes Biochem J 382, 1–7 Fortpied J, Gemayel R, Stroobant V & Van Schaftingen E (2005) Plant ribulosamine ⁄ erythrulosamine 3-kinase, a putative protein-repair enzyme Biochem J 388, 795–802 FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS 4373 Bacterial fructosamine 3-kinase homologues R Gemayel et al Fortpied J, Gemayel R, Vertommen D & Van Schaftingen E (2007) Identification of protein-ribulosamine-5phosphatase as human low-molecular-weight protein-tyrosine-phosphatase-A Biochem J 406, 139–145 Vincent C, Doublet P, Grangeasse C, Vaganay E, Cozzone AJ & Duclos B (1999) Cells of Escherichia coli contain a protein-tyrosine kinase, Wzc, and a phosphotyrosineprotein phosphatase, Wzb J Bacteriol 181, 3472–3477 Kuznetsova E, Proudfoot M, Gonzalez CF, Brown G, Omelchenko MV, Borozan I, Carmel L, Wolf YI, Mori H, Savchenko AV et al (2006) Genome-wide analysis of substrate specificities of the Escherichia coli haloacid dehalogenase-like phosphatase family J Biol Chem 281, 36149–36161 10 Delplanque J, Delpierre G, Opperdoes FR & Van Schaftingen E (2004) Tissue distribution and evolution of fructosamine 3-kinase and fructosamine 3-kinaserelated protein J Biol Chem 279, 46606–46613 11 Soulat D, Vaganay E, Duclos B, Genestier A, Etienne J & Cozzone AJ (2002) Staphylococcus aureus contains two low-molecular-mass phosphotyrosine protein phosphatases J Bacteriol 184, 5194–5199 12 Delpierre G, Vertommen D, Communi D, Rider MH & Van Schaftingen E (2004) Identification of fructosamine residues deglycated by fructosamine-3-kinase in human hemoglobin J Biol Chem 279, 27613–27620 13 Wiame E, Delpierre G, Collard F & Van Schaftingen E (2002) Identification of a pathway for the utilization of the Amadori product fructoselysine in Escherichia coli J Biol Chem 277, 42523–42529 14 Wiame E, Lamosa P, Santos H & Van Schaftingen E (2005) Identification of glucoselysine-6-phosphate deglycase, an enzyme involved in the metabolism of the fructation product glucoselysine Biochem J 392, 263–269 15 McKay GA, Thompson PR & Wright GD (1994) Broad spectrum aminoglycoside phosphotransferase type III from Enterococcus: overexpression, purification, and substrate specificity Biochemistry 33, 6936–6944 16 Sandwick R, Johanson M & Breuer E (2005) Maillard reactions of ribose 5-phosphate and amino acids Ann N Y Acad Sci 1043, 85–96 17 Veiga-da-Cunha M, Santos H & Van Schaftingen E (1993) Pathway and regulation of erythritol formation in Leuconostoc oenos J Bacteriol 175, 3941–3948 18 Li C & Clarke S (1992) A protein methyltransferase specific for altered aspartyl residues is important in Escherichia coli stationary-phase survival and heat-shock resistance Proc Natl Acad Sci USA 89, 9885–9889 19 Moskovitz J, Rahman MA, Strassman J, Yancey SO, Kushner SR, Brot N & Weissbach H (1995) Escherichia coli peptide methionine sulfoxide reductase gene: regulation of expression and role in protecting against oxidative damage J Bacteriol 177, 502–507 20 Collet JF, D’Souza JC, Jakob U & Bardwell JC (2003) Thioredoxin 2, an oxidative stress-induced protein, 4374 21 22 23 24 25 26 27 28 29 30 contains a high affinity zinc binding site J Biol Chem 278, 45325–45332 Fortpied J, Maliekal P, Vertommen D & Van Schaftingen E (2006) Magnesium-dependent phosphatase-1 is a protein-fructosamine-6-phosphatase potentially involved in glycation repair J Biol Chem 281, 18378–18385 Park JT & Johnson MJ (1949) A submicrodetermination of glucose J Biol Chem 181, 149–151 Studier FW & Moffatt BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes J Mol Biol 189, 113–130 Veiga-da-Cunha M, Courtois S, Michel A, Gosselain E & Van Schaftingen E (1996) Amino acid conservation in animal glucokinases Identification of residues implicated in the interaction with the regulatory protein J Biol Chem 271, 6292–6297 Wiame E & Van Schaftingen E (2004) Fructoselysine 3-epimerase, an enzyme involved in the metabolism of the unusual Amadori compound psicoselysine in Escherichia coli Biochem J 378, 1047–1052 Bradford MM (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye-binding Anal Biochem 72, 248–254 Maliekal P, Vertommen D, Delpierre G & Van Schaftingen E (2006) Identification of the sequence encoding N-acetylneuraminate-9-phosphate phosphatase Glycobiology 16, 165–172 Itaya K & Ui M (1966) A new micromethod for the colorimetric determination of inorganic phosphate Clin Chim Acta 14, 361–366 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res 25, 3389–3402 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25, 4876–4882 Supplementary material The following supplementary material is available online: Table S1 Distribution of fructosamine 3-kinase (FN3K) and low-molecular-weight protein-tyrosinephosphatase (LMW-PTP) homologues in prokaryotes This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 4360–4374 ª 2007 The Authors Journal compilation ª 2007 FEBS ... 4363 Bacterial fructosamine 3-kinase homologues R Gemayel et al Fig Alignment of human fructosamine 3-kinase (FN3K) and fructosamine 3-kinaserelated protein (FN3K-RP) with the bacterial homologues. .. Histidine kinase LMW-PTP FN3K Hypothetical IndA protein protein Thermus thermophilus Fig Genomic environment of some bacterial fructosamine 3-kinase (FN3K) homologues. The genomic arrangements are. .. homologues are ribulosamine ⁄ erythrulosamine 3-kinases Four of the five bacterial FN3K homologues that we studied are ribulosamine ⁄ erythrulosamine 3-kinases This property is shared by mammalian and