women apos s swimming she set a new world record time of
Tài liệu tiếng anh Điện tử công suất mạch MERS A new automatic voltage regulator of self excited induction generator using SVC magnetic energy recovery switch
... 40 S2 , S4 ON VLL Vdc Equivalent circuit of SVC MERS is close to 30Ó and in this case reactance of SVC MERS ( ×Ú Đ Ư× ) is equal to real reactance of MERS capacitor ( ) Dc-offset mode appeares ... This can be achieved by switching off all IGBTs, it can be shown that in the dc capacitor some voltage was appeared As load increased, terminal voltage decreased When voltage is less than 5%, SVC ... (deg) Steady state voltage characteristic Ishunt Iload per unit calculation, which base voltage is 200V, base current is 6. 8A and base frequency is 1500 rpm Capacitor voltage (V) −10 A Constant Speed...
- 7
- 834
- 2
A new algorithm for enumeration of minimum cutsets of graph by branch addition
... version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and subtransmission system (Khorasan regional network) This network ... and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus & Systems, ... The most important advantage of the new algorithm is less time consuming compared with the other minimum cutset enumeration algorithms Therefore, it is very suitable to use in transmission system...
- 6
- 545
- 0
A new mechanism for modulation of schottky barrier heights on silicon nanowires
... interface as a function of the sulphur surface concentration taking this depth as a reasonable value for substantial tunneling This gives an energy lowering similar to the experimental data as given ... Pd2Si solely in contact with the end surfaces of the wires were obtained by annealing at 250 1C for 20 Using the Pd2Si contacts as source and drain and the silicon substrate as a back-gate, a ... transistor configuration can be defined as shown in Fig 5 (a) Transfer characteristics at different temperatures for a constant drain voltage of À5 V are shown in Fig Three different regimes can...
- 5
- 398
- 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc
... Sri Krishnan s research interests include adaptive signal processing, biomedical signal/image analysis, and multimedia processing and communications He is a registered Professional Engineer of ... estimating the IF of a signal For simple applications such as in the analysis of monocomponent signal, Cohen s class TFDs or model-based TFDs may be applied It is widely accepted that, in case ... synthetic signals and realworld signals are discussed and compared with those obtained from other TFDs in Section A summary is given in Section REVIEW The classical definition of the IF of a signal is...
- 8
- 355
- 0
Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf
... loss (aggrecan degradation) and collagen release These processes are associated with decreased levels of ADAMTS4 and -5 and of MMP13, respectively, and message levels of these gene products were ... inhibitors Eur J Med Chem 2005, 40:1-13 Nishida K, Komiyama T, Miyazawa S, Shen ZN, Furumatsu T, Doi H, Yoshida A, Yamana J, Yamamura M, Ninomiya Y, et al.: Histone deacetylase inhibitor suppression of ... metalloproteinase expression in cartilage and demonstrates that the paradigm of inhibition of histone deacetylation leading to gene silencing is not absolute Cawston and colleagues showed many...
- 2
- 397
- 0
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... GGACTCATGACCACAGTCCATGCC Antisense: TCAGGGATGACCTTGCCCACA Bone-specific genes ALP Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC OC Sense: ATGAGAGCCCTCACACTCCTC Antisense: ... GCCGTAGAAGCGCCGATAGGC Adipose-specific genes LPL Sense: GAGATTTCTCTGTATGGCACC Antisense: CTGCAAATGAGACACTTTCTC PPARγ Sense: TGAATGTGAAGCCCATTGAA Antisense: CTGCAGTAGCTGCACGTGTT Cartilage-specific ... genes AGN Sense: TGCGGGTCAACAGTGCCTATC Antisense: CACGATGCCTTTCACCACGAC COL 2A1 Sense: GGAAACTTTGCTGCCCAGATG Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ALP, alkaline phosphatase; COL 2A1 ,...
- 12
- 359
- 0
the age of turbulence adventures in a new world phần 4 docx
... is how the official put it, explaining that Japanese banks had lost confidence in Korea and were about to stop renewing tens of billions of dollars in loans This was a shock A symbol of Asia 's ... forward a $40 billion package of loan guarantees for congressional approval As dramatic as that gesture was, within days it became clear that politically the bailout didn't have a prayer Americans ... Mississippi and Missouri rivers paralyzed nine midwestern states NASA astronauts went into orbit to repair the Hubble Space Telescope There was a failed coup against Boris Yeltsin, and Nelson...
- 57
- 391
- 0
the age of turbulence adventures in a new world phần 6 pdf
... 750 failed savings-and-loan associations, and how, as soon as most of the seemingly unsellable real estate had been cleared off the shelves, the real estate market had revived and the new, smaller ... back from the stock-market and real estate crash of 1990 Japanese banks became heavily invested in loans backed by real estate as collateral, as real estate prices soared When the turn came and ... remains rooted in the values of our Founding Fathers As unfettered as today 's American capitalism may appear, it is a pale image of the capitalism of our earlier years We probably came as close...
- 57
- 404
- 0
the age of turbulence adventures in a new world phần 8 ppt
... capital assets must equal the market value of those assets In a sense, the world 's checkbook must balance Savings, in the end, must equal investment for the world as a whole But businesses and households ... inventories, and homes must always be equal to global savings—the net means of financing these investments Every asset must have an owner The market value of "paper" claims against newly created capital ... includes such safeguards as deposit insurance, bank access to the Fed 's discount facilities, and access to the Fed 's vast electronic payments system—reduces the importance of reputation as a constraint...
- 57
- 396
- 0
the age of turbulence adventures in a new world phần 10 ppsx
... and Germany 's Federal Statistical Office, as well as central banks Professionals at dozens of organizations, associations, and companies responded helpfully to requests for information and data: ... markets The international financial market has become so large and liquid* that sales of tens of billions of U .S treasuries, perhaps hundreds of billions, can be transacted without crisis-causing shocks ... those of Japanese ancestry Its level of technology is already world- class, so its upside potential for productivity growth is presumably as limited as that of the United States Many forecasters see...
- 48
- 338
- 0
báo cáo khoa học: "Sheehan’s syndrome with pancytopenia: a case report and review of the literature" ppt
... possibility of hypopituitarism as a cause of pancytopenia and indicate a series of hormonal examinations Multiple anterior pituitary hormone deficiencies in Sheehan s syndrome can be responsible ... hypocellularity and decreased hemopoiesis, erythropoiesis and granulopoiesis Pancytopenia as a result of an anterior hormone deficiency has not been clearly investigated It is a consequence of the loss ... References Anfuso S, Patrelli TS, Soncini E, Chiodera P, Fadda GM, Nardelli GB: A case report of Sheehan s syndrome with acute onset, hyponatremia and severe anemia Acta Biomed 2009, 80(1):73-76 Huang...
- 3
- 362
- 0
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt
... Isolation of DNA, genotyping of 5-HTTLPR and rs25531, as well as the classification of estimated phased haplotypes (SASA, SGSG, LGSA, and LGLG as S S ; LA SA and LALG as L S ; and LALA as L’L’) ... 5-HTTLPR/rs25531 was analyzed by analysis of variance, using the HA score as the dependent variable, genotypes and sex as independent variables, and age as a covariate (ANCOVA) The p-values have been ... heterogeneity was assessed using a c2 test of goodness of fit and I2 statistic [38] The significant p value was set at 0.05 In a fixed effects model, the fundamental assumption is that a single true...
- 12
- 400
- 0
Báo cáo y học: "A new integrative weaning index of discontinuation from mechanical ventilation" pot
... data concerning the other 216 patients Statistical analysis Continuous variables were presented as mean and standard deviation, categorical variables as frequencies and percentages Student 's t ... test was used to compare parametric variables and Mann-Whitney test to compare non-parametric ones P values less than 0.05 were considered significant The statistical analysis was performed using ... Conclusions The use of an index, such as IWI, that integrates important weaning parameters can evaluate the weaning outcome with better accuracy A satisfactory oxygenation and Cst,rs when associated...
- 9
- 234
- 0
A new hybrid treatment system of bioreactors and electrocoagulation for superior removal of organic and nutrient pollutants from municipal wastewater
... M., Ohashi, A. , Harada, H., 2007 Performance comparison of a pilot-scale UASB and DHS system and activated sludge process for the treatment of municipal wastewater Water Res 41, 2697–2705 Wahab, ... that in MBR as in addition to being available in the inflow of wastewater, alkalinity is also Table Summary of some key operating parameters and results during operation of EC process No Parameters ... Wahab et al., 2011; Oleszkiewicz and Barnard, 2006; Bektas et al., 2004) For these reasons and others, this EC proß cess study was applied as a post treatment add-on, with potential for reasonably...
- 11
- 565
- 0
Analyzing the markets opportunity for a new product the case of thread deformed bar steel of vina kyoel steel company
... Exploratory factor analysis, the fourth step is Correlation testing, the fifth step is Regression analysis, and the final step is Crosstabs analysis 3.5.1 Descriptive statistics "Descriptive statistics ... 3.1 Sampling Population sampling is the process of taking a subset of subjects that is representative of the entire population “The sample must have sufficient size to warrant statistical analysis” ... To assess the reliability and validity of measurement scales, Cronbach s Alpha was used in this research Cronbach s Alpha was used to eliminate garbage items with low item – total correlations...
- 83
- 425
- 0
53225 conversation moving to a new world
... As a follow up to this exercise, you can create a scenario in which the students themselves are in a similar situation – for instance, a boat/hot air balloon that is approaching a desert island ... is sinking due to excess weight Each student must then give a reason/reasons why they deserve to stay on the desert island After each student has given their reasons, they must vote (perhaps anonymously) ... changed, and each pair must work with another pair to compromise again on another people to take Depending on the class-size, this could then involve a whole class discussion on who deserves to be saved...
- 2
- 286
- 0
Special events event leadership for a new world fourth edition by dr joe goldblatt
... Retailers have historically used events to drive sales, and now other types of businesses are realizing that face-to-face events are an effective way to satisfy sales goals The appearance of soap ... attract thousands of consumers to their stores Soap opera stars, sports celebrities, and even live cartoon characters during a Saturday appearance could increase traffic and, in some cases, sales ... previous editions of Special Events, these individuals have provided valuable insights: Eva Barkoff Jaclyn Bernstein Tatiana Chernauska Sara and Frank Cohen Alice Conway, CSEP Sally Elstrod Linda Faulkner...
- 546
- 418
- 0
3 5 2 exploring a new world
... land on October 12, 1492, he was sure the island was near China but it was San Salvador in the Bahamas Columbus went on to Hispañola and Cuba Columbus made three later trips back to this area ... fleet of five ships and soldiers to explore on land One ship turned back at Ireland and the other ships were never heard from again John Cabot explored part of eastern Canada s coast Spain Starts ... India and China faster than other explorers He was Italian but went to Spain s king and queen to ask for money They agreed Columbus sailed three small ships across the Atlantic Ocean When he reached...
- 10
- 165
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25