women aged 18 years and older by household type and race ethnicity 1998
actual situation of lower genital tract infections in married women aged 18-49 in the marine and island areas, hai phong city and effectiveness of some intervention solutions ttta
... counseling Chapter SUBJECTS AND METHODS 2.1 Study subjects, sites and time - Study subjects were women aged 18- 49 years old, married, living in the marine and island area of Hai Phong City - ... Describe the actual situation and some factors related to the lower genital tract infections in married women aged 18- 49 in three districts of the marine and island area of Hai Phong City in ... LGTIs in all the women examined, by location and combination mode of infection (n = 804) The number of women with single vaginosis accounted for the highest rate (23%), followed by women with single...
- 24
- 383
- 0
Gait speed and risk assessment for falls among men aged 80 years and older a prospective cohort study in taiwan
... programs, and were a simple and efficient approach to stratify risk of falls for people aged 80 years and older Table Independent risk factors for falls among men aged 80 years and older during ... people aged 90 years and older [31], and the 6month multidimensional training program may sustain the beneficial effects upon the increasing gait speed, as well as the Among men aged 80 years and older ... IADL, and depressive symptoms based on GDS-15, and gait speed (m/s) Please cite this article in press as: Liang C-K, et al Gait speed and risk assessment for falls among men aged 80 years and older: ...
- 5
- 283
- 0
Fertility of Men and Women Aged 15–44 Years in the United States: National Survey of Family Growth, 2006–2010 docx
... for women and men: United States, 2006–2010 Women Men Probability of a first birth by Probability of a first birth by Characteristic 18 years 20 years 25 years 30 years 35 years 40 years 18 years ... origin and race group, married men and women had a higher mean age at first birth than unmarried men and women The text table shows the number of children born to women aged 15–44 years by their ... (1.6) 41.4 (1.5) 18. 2 (1.4) 25.4 (1.1) 15.6 (1.4) 16.0 (0.9) Age at Under 20 years Under 18 years 18 19 years 20–24 years 25–44 years 25–29 years 30–44 years first...
- 29
- 756
- 0
Midlife and Older Women Family Life, Work and Health in Jamaica pot
... 976-640 -183 -7 Middle -aged women – Jamaica Older women – Jamaica Women – Employment – Jamaica Women – Health and hygiene – Jamaica I Title HQ1059.5.J3R385 2006 331.4’097292 Book and cover design by ... and family life for midlife and older women FAMILY AND HOUSEHOLD: AN OVERVIEW The family and the household are two of the main institutions in which women midlife and older interact It is within ... her By day, Hope Pastures was a very quiet place Husbands and wives and young adults were away at work, and children and grandchildren were at school Maids and gardeners were within the yards and...
- 184
- 380
- 0
báo cáo hóa học:" Modification of the asthma quality of life questionnaire (standardised) for patients 12 years and older" pdf
... were 2207 over 18 years and 216 between 12 and 17 years (Table 3) In the older patients there were slightly more women than men and in the younger patients slightly more men than women FEV1% predicted ... properties of the AQLQ(S) for 12 years and older (AQLQ12+) in patients 12–17 years and patients ≥ 18 years Methods Modification of the AQLQ(S) Both the AQLQ [1] and the Paediatric Asthma Quality ... values Study Study ≥ 18 years ≥ 18 years 12–17 years 1652 44.8 (18 80) 41.1/58.9 75.4 (32–136) Number of patients Mean age (range) Gender M/F (%) FEV1% pred (range) 12–17 years 116 14.3 (12–17)...
- 6
- 486
- 0
báo cáo khoa học:" Predictors of mortality and short-term physical and cognitive dependence in critically ill persons 75 years and older: a prospective cohort study" ppt
... [5] and dialysis results [35], respectively, as predictive factors for death in patients 70 years and older with abdominal pathologies and in mixed medicalsurgical populations 80 years and older ... to 74 years old and 21% in patients 64 years old and younger during the same period, data not shown) Moreover, the study includes a high proportion (39%) of older persons 80 years and older Finally, ... category and scored between (maximum quality) and 100 (no quality) In each category, the worst score obtained was 100 and the best The aggregate sum varied between 600 (maximum handicap) and (no handicap)...
- 9
- 224
- 0
TChon 18 COMPARATIVE AND SUPERLATIVE ADJECTIVES.doc
... 8 10 11 12 13 14 15 16 17 18 → My mother can cook He does not play tennis as well as Jack → Jack can ...
- 2
- 1,714
- 95
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf
... targeting and pore formation by the T3SS (YopB) and pathogenic Escherichia spp (EspD) all carry two predicted TM regions, and are predicted to have a N-terminal coiled-coil region and, occasionally, ... membrane and increasing Salmonella invasion efficiency [62] It is of note that both IpaC and SipC are essential for Shigella and Salmonella uptake by macrophages in the early steps of invasion, and ... targeting and pore formation by the T3SS P.-J Matteı et al ¨ des Sciences du Vivant (DSV), CEA P.J.M was supported by a PhD fellowship from the Rhone-Alpes ˆ region and T.I was supported by a PhD...
- 13
- 647
- 0
Tài liệu Greek Women Women In All Ages and In All Countries, Vol. l (of 10) potx
... Hector smiles and gazes at the boy; while Andromache stands by his side weeping and clasps his hand in hers, and urges him to take thought for himself and to have pity on her, forlorn, and on their ... love and beauty and the idealization of feminine graces and charm; Artemis, the maiden divinity never conquered by love, and the protectress of maidens; and Hestia, goddess of the hearth and preserver ... femininity They have had prototypes and antitypes, and many Women have achieved their most decisive and remarkable effects upon the history of mankind by reaching and clinging to extremes Extremism...
- 150
- 541
- 0
Reproductive and Child Health Project Rapid Household Survey (Phase I & II) 1998-1999 ppt
... age 18 In Andhra Pradesh, Bihar, Madhya Pradesh, and Dadra & Nagar Haveli 70 percent or more women married below age 18 On the other hand, in Goa, Jammu & Kashmir, Meghalaya, Mizoram and Nagaland ... Nadu (2.92), Chandigarh (2.72) and Pondicherry (2.90) women aged 40-44 have comparatively fewer number of surviving children Only in Meghalaya (5.54) and Nagaland (5.4) women aged 40-44 have ... CHARACTERISTICS OF HOUSEHOLDS AND WOMEN The socioeconomic characteristics of both the households and the women play an important role in determining the utilization of Reproductive and Child Health...
- 113
- 489
- 0
WOMEN’S HEALTH PREVENTION AND PROMOTION pot
... women increases with age African American and Hispanic women are more likely than other women to be overweight or obese (see Figure 10) Figure 9: Overweight and Obesity in Women Aged 18 and Older, ... Services; 2004 Figure 10: Overweight and Obesity in Women Aged 18 and Older, by Race/ Ethnicity, 2002 �� �� ���������������� Recommended Practices Among overweight and March 2005 more Although not ... 223 Miedema, B and Tatemichi S Breast and Cervical Cancer Screening for Women between 50 and 69 Years of Age: What Prompts Women to Screen? Women s Health Issues 2003: 13(5) :180 -184 224 National...
- 48
- 476
- 0
Recommendations for Use of Antiretroviral Drugs in Pregnant HIV-1-Infected Women for Maternal Health and Interventions to Reduce Perinatal HIV Transmission in the United States pdf
... Breastfeeding and Nutrition (BAN) study in Malawi Preconception Counseling and Care for HIV-Infected Women of Childbearing Age and Table 4, Drug Interactions Between Hormonal Contraceptives and Antiretroviral ... remembered as a leader in and advocate of pediatric and perinatal HIV research Panel members hope to honor Dr Handelsman’s legacy by continuing his work to save the lives of women and children worldwide ... transmission at birth were similar in women randomized to a triple-drug regimen (1.8%) and women randomized to antepartum zidovudine/single-dose nevirapine (2.5%); for women with CD4-cell counts from...
- 235
- 1,501
- 0
Improving Women’s Health Issues and Interventions docx
... commitment and behavior change at the community and household levels Unequalpower between men and women in sexual relationships expose women to involuntary sex, unwanted pregnancy, and sexually ... education and employment opportunities for women will have a positive impact on the health of women and their families In the short term, significant progress can be achieved by strengthening and expanding ... services for women, improving policies, and promoting more positive attitudes and behavior towards women' s health WOMEN' S HEALTH: ISSUESAND INTERVENTIONS IMPROVING INTRODUCTION Access by the poor...
- 41
- 331
- 0
Exploring Linkages: Women’s Empowerment, Microfinance and Health Education docx
... regarding daily household purchases? Client Mostly client Client and husband equally Mostly husband Husband Client Mostly client Client and husband equally Mostly husband Husband Client Mostly ... income and negotiating power, women are better able to exercise their right to sexual and reproductive health And when women are better off, so are families and societies Women s empowerment and ... social and economic barriers prevent women from accessing education, finance and health services To combat poverty, it is critical that programmes and initiatives target women specifically By emphasizing...
- 15
- 343
- 0
The Future of Organization’s Computer Network Security for the Next 5 Years (2011-2015) by Using Delphi Technique doc
... next years We started by studying and collecting information about computer network security and about the Delphi technique The next step is conducted as the follows 3.1 Research Procedure 185 ... consists of the provisions and policies adopted by the network administrator to prevent and monitor unauthorized access, misuse, modification, or denial of the computer network and network-accessible ... research procedure and questionnaires, explain the research results in section indicating organization’s computer network security in today’s market and for the next Years, and summarization in...
- 5
- 550
- 0
Beyond Bias and Barriers: Fulfilling the Potential of Women in Academic Science and Engineering docx
... Science and Engineering, by Race or Ethnicity and Sex, 2003, 70 Primary Source of Support (Percent) for US Citizen and Permanent Resident Science and Engineering Doctorate Recipients, by Sex and Race ... experience and expectations of women vary by race and ethnicity. c The additional challenges that girls and women in ethnic and racial minority groups face in attaining scientific and engineering ... Coursework in Mathematics and Science, by Sex and Year of Graduation, 60 Percentages of First-Year College Students Intending to Major in Science and Engineering, by Sex and Race or Ethnicity, 2004, 62...
- 347
- 463
- 0
Eighty Years And More; Reminiscences 1815-1897 potx
... Eighty Years And More; Reminiscences by Elizabeth Cady Stanton Eighty Years And More; Reminiscences by Elizabeth Cady Stanton The Project Gutenberg EBook of Eighty Years And More; Reminiscences 181 5 -189 7, ... EIGHTY YEARS AND MORE *** Produced by Suzanne Shell, Grenet and the Online Distributed Proofreading Team [Illustration: Elizabeth Cady Stanton] EIGHTY YEARS AND MORE REMINISCENCES 181 5 -189 7 ELIZABETH ... dogmas they fully believed As Mr Birney and my husband were invited to speak all over England, Scotland, and Ireland, and we were uniformly entertained by orthodox Friends, I had abundant opportunity...
- 194
- 266
- 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc
... TGCCAGATCTTCTCCATG TGGTACCACTCAACATGTCAGTAAGCG 3¢ -RACE 5¢ -RACE 5¢ -RACE 3¢ -RACE Gene organization 3¢ -RACE 5¢ -RACE 5¢ -RACE IL-18A expression IL-18B expression IL -18 expression Gene expression Gene expression ... than IL-18A was dominantly expressed after stimulation with LPS (IL-18B/IL-18A 3.0) or poly(I:C) (IL-18B/IL-18A 1.7) rIL-1b decreased expression of IL-18A and to a lesser extent IL-18B mRNA ... revealed that the trout IL -18 molecule grouped closely with other known IL -18 s (data not shown), and away from IL-1a, IL-1b and IL-1Ra acids, respectively (termed IL-18A and IL-18B) (Fig 4) The 17...
- 11
- 426
- 0
International lung cancer trends by histologic type: male:female differences diminishing and adenocarcinoma rates rising pot
... earlier years Rates among women rose virtually everywhere, more than doubling in Norway and tripling in the Netherlands Among U.S black women, rates peaked around 1990 and subsequently dropped by ... in U.S whites, Canada and Iceland, after being around in the early years in North America, Australia, Denmark and Norway, and exceeding 10 in the Netherlands, Italy, France and Spain In contrast ... areas, such as Canada, U.S whites and Denmark, while declines in recent years were suggested for U.S blacks, in Switzerland and possibly Iceland In the earlier years, the male:female rate ratio...
- 6
- 349
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25