what is an example of a food chain in the tropical rainforest
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCCJH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCCJH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCCJH6.link ... used as a potential component of a recombinant antiserumagainst Centruroides stings. These results open newavenues for the generation of recombinant antiseraagainst deadly animals.Experimental ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCCVK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCCVK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCCVK6.link...
- 11
- 679
- 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... behaviour and trying to find patterns in it;4. Information Access and Management:Information access and management is an area of great activity, given the rise in popularity of the Internet ... said as well: in many cases the individual agents of a system aren't that intelligent at all, but the combination and co-operation of them leads to the intelligence and smartness of an ... heard -of examples of such an application is the groupware packet called Lotus Notes;6. Workflow and Administrative Management:36Administrative management includes both workflow management and...
- 100
- 811
- 3
an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... andManagement:Information access andmanagement is an area of greatactivity, given the rise in popularity of the Internet and the explosion of data available tousers. It is the application area thatthis ... build and manage Preamble1 Preamble1.1 AbstractSoftware agents are a rapidlydeveloping area of research. However,to many it is unclear what agents areand what they can (and maybe cannot)do. ... questionwho is supplying the information hasbecome less important: demand forinformation is becoming the mostimportant aspect of the information chain. What& apos;s more, information is playing an increasingly...
- 100
- 412
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... Bioscience (Maarsen, the Netherlands).Bacterial strains The E. coli K-12strainsusedinthisstudyarelistedinTable 1. Strains CE1514 and CE1515 were obtained by P1transduction using strain CE1224 as the ... SecB-preproteincomplexisthentargetedtoSecA,whichinturninteractswith components of the Sec translocon [5,6]. At the onset of translocation, SecB is released [7] and the preprotein is translocated by an insertion–deinsertion ... indicating that they are targeted to the Sec translocon via another targeting pathway. In vitrocross-linking with the water-soluble cross-linker BS3revealed that the G-10C and G-10L 94PhoE nascent...
- 8
- 546
- 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... can lead to an information gap that is readily lled by the grapevine.This has created a new kind of challenge for managers—that of nding a reliable source of information and keeping an adequate ... people-dependant. This book discusses various aspects of managing that a manager deals with on a daily basis, such as team building, hiring, motivating your team, planning, and many more. It also attempts ... ecosystem. These in uences are created by the organization in general and you in particular. There are so many things a manager is supposed to do.At different points of the day and each day of the...
- 328
- 4,476
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... FragariaxananassaUGT78D1 A. thalianaUGT8 6A1 A. thalianaUGT8 7A1 A. thalianaUGT8 3A1 A. thalianaUGT8 2A1 A. thalianaUGT8 5A1 A. thalianaSbHMNGT S. bicolorUGT76D1 A. thalianaUGT76E1 A. thalianaS39507 ... thalianaOsSGT1 O. sativaUGT74F1 A. thalianaUGT74F2 A. thalianaNtGT2 N. tabacumUGT75C1 A. thalianaUGT75B1 A. thalianaUGT75D1 A. thalianaUGT84B1 A. thalianaUGT8 4A1 A. thalianaFaGT2 FragariaxananassaUGT78D1 ... lycopersicumUGT76F1 A. thalianaCAO69089 V. viniferaUGT76B1 A. thalianaUGT76C1 A. thalianaUGT71B1 A. thalianaCaUGT1 C. roseusUGT71C1 A. thalianaUGT71D2 A. thalianaUGT8 8A1 A. thalianaUGT72E2 A. thalianaUGT72E3...
- 11
- 661
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... addition of water. The hypothesis that the ketointermediate has a cis rather than trans geometry is based on the observation that the enzyme cannothydrate the trans-keto form of HPDA that is spontane-ously ... University of Guelph, Ontario, CanadaMicrobial degradation of aromatic compounds is important for maintaining the global carbon cycle andalso for the bioremediation of man-made aromaticcompounds, ... polymerase werefrom Invitrogen (Burlington, Ontario, Canada) or NewEngland Biolabs (Pickering, Ontario, Canada). All otherchemicals were of analytical grade and were obtained fromSigma-Aldrich and...
- 9
- 461
- 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... can also occur. Phenological data are a certain expression of the climate character of a given region. us, they can contribute to assess the variability of weather and also to evaluate the ... of all monitored stages. Differences in the onset of phenological stages of the Norway spruce budbreak and of the beginning of foliage in European beech and European larch in a mixed stand in ... e area is characterized by coordinates 16°41'30''E and 49°26'31''N in the geo-graphical unit of the Drahanská vrchovina Upland. Climatically, the region is slightly...
- 12
- 386
- 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
... the Euclidean distance matrix comparing all the individual trees. Prior to the analysis, the data were standardised (zero mean and unit variance).Based on the similarity transformed distance matrix, a ... change mean curve (AGCmcurve) was based on annual values and was the mean of all AGC singlevalues of all bog pines of the transect, using the median percentagevalues (for the reduction class ... Gobat J M., Standstructure, invasion and growth dynamics of bog pine (Pinus uncinatavar. rotundata) in relation to peat cutting and drainage in the JuraMountains, Switzerland, Can. J. For. Res....
- 10
- 277
- 0
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... Haegeman et al. [12] also report the alanine to valine substitution aswell as an amino acid change from Glu to Arg in exon 3. Only two of the 106 F.C. Buchanan et al.or central administration ... residual error. The results from the RPA were analyzed using a one-way ANOVA. Leptin SNP correlated with fat and mRNA levels 115amplification, cloning, partial sequence analysis, and use as loading ... # AB003143) [33]. The other SNP located in exon 3 also encoded an amino acid change; alaninewas substituted with valine. This SNP was not analyzed further because it 110 F.C. Buchanan et al.Figure...
- 12
- 321
- 0
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx
... 15 analysed for each animal.III. Results and discussion The distribution of the karyotype classes observed in the offspring of the 2 bullsare shown in table 1. In bull ... reached the testis and failed to survive in a foreign environment, or that late vascular anastomosisprevented their migration in the first place. The discovery of the ... submetacentricmarker chromosome, as against cells with a normal karyotype (MORAES et al., 1980).Because of the chimeric nature of the twins and the rarity of the insertion...
- 5
- 319
- 0
Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc
... findings.Conclusion: A diagnostically challenging case of median neuropathy in the forearm is presented in which high-resolution ultrasound was valuable in establishing an anatomic etiology and directingappropriate ... of degenerative disc disease and the nature of the injury, but an MRI and CT myelogram of the cervical spine showedno changes compared to his previous cervical spineimages. It was then assumed that ... right-handed man with a history of degen-erative cervical disc disease presented with complaints of right hand and forearm weakness that started 6 monthsearlier following an acute traction injury...
- 4
- 372
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25