... c u tr c tr cCc bư c s d ng: ng: Khai báo l p (file h): t o ki u cho đ i tư ng ng class p> { ; tính>; ; c> ; }; C i đ t l p (file cpp): c i ... Nguy n Minh Huy 13 T mv c Dr Guru khuyên: khuyên: Quy t c h p đen: đen: Thu c tính c t m v c private đ h n ch truy xu t t Phương th c có t m v c public đ cung c p tính năng class PhanSo { private: ... ng l p Đ i tư ng gì? gì? Chương trình c máy” ph c t p máy” p C u thành t nhi u lo i “chi ti t” t” Chi ti t b n: hàm, c u tr c n: hàm, tr c Đã đ t o chương trình t t? t? Chi ti t m i: Đ i tư ng!!...
... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because ... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6]...
... functionality of Cre or FLP recombination targets in genomic manipulation constructs Nucleic Acids Res 24, 3118–3119 ¨ 17 Lorbach, E., Christ, N., Schwikardi, M & Droge, P (2000) Sitespeci c recombination ... recombination in cell line TRE2/3 which contains a single copy of the vector The analysis was performed in the absence of doxycyclin, i.e the TRE-CMV promoter is active and transcription proceeds ... amount of gd102NLS is present in CHO cells throughout the time course of our experiments [10], neither changes in chromatin structure occurring during the cell cycle nor the passage of a replication...
... the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ ... a cDNA clone corresponding to the 3¢-end of human MUC5AC inserted into a pBluescript vector, was used as a template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ ... part of the figure Dimer, dimeric M-MUC5AC-CH; Monomer, monomeric M-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- terminal cleavage fragment; M -C1 , N-terminal cleavage fragment The position of...
... insertion of a linker sequence formed by the oligonucleotides ZlibHisStop-1: 5¢-TCGACCCATCAT CATCATCATCATTAATAAGTCGAC-3¢ and ZlibHisStop-2: 5¢-TCGACGTCGACTTATTAATGATGATGA TGATGATGATGGG-3¢ encoding ... reference surface (ABD) was used to produce subtractive sensorgrams IgA-speci c affibody ligands (Eur J Biochem 269) 2649 Construction and production of dimeric (head-to-tail) affibody constructs The ... therapeutic use are currently under investigation in clinical trials [34] The majority of those are of IgG isotype, which can effectively activate complement- and antibodydependent cellular cytotoxicity...
... at an acceptable price • the supply of product at a price acceptable to the consumer • the removal of uncertainty concerning future organic livestock standards and regulations ix ORGANIC POULTRY ... by-products The results of these two scenarios are shown in each of the following tables and the consequences discussed in the conclusion to this section In some cases, the consequences of restricting ... presence of cocks is not strictly necessary, even though some people have argued that the presence of approximately one cock for every 30 hens can have a calming effect (Fölsch, 1986) One organic...
... and LPS -II (lane 2) ofC braakii PCM 1531, LPS of Citrobacter PCM 1504 (lane 3), LPS of Citrobacter PCM 1505 (lane 4) and LPS of Citrobacter PCM 1487 (lane 5) LPS-I) and OPS -II (from LPS -II) were ... O-polysaccharide from Citrobacter braakii O6 (Eur J Biochem 270) 2735 Fig Part of a two-dimensional 1H,1 3C HSQC spectrum of the O-speci c polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional ... residue of Rha at the branching point Elucidation of the structure of the O-speci c polysaccharide by NMR spectroscopy The 1 3C NMR spectra of OPS-I and OPS -II were essentially identical, and...
... academic as well as practical exposure and we look forward to more of such visits in future to enhance both our theoretical, technical and practical knowledge Alcoholic Beverages An alcoholic ... The consumption of alcohol is often important at social events in such societies and may be an important aspect of a community's culture The concentration of alcohol in a drink may be specified ... Danish scientist Hansen Nowadays there are two main varieties of yeasts that are used in brewing: saccharomyces cerevisiae and saccharomyces carlsbergensis (bottomfermenting) Certain other products...
... include the C+ and C coalescence points and quartic bifurcation points which can occur at certain singularities of the system (32) Extended systems for these singularities may be found in Cliffe ... of experience guarantee authors the best possible service To reach the goal of rapid publication at a low price the technique of photographic reproduction from a camera-ready manuscript was chosen ... should check the contributions for the correct use of language At Springer-Verlag only the prefaces will be checked by a copy-editor for language and style Grave linguistic or technical shortcomings...
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... domain II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...
... concentrations are intended: Acetic acid (HC2H3O2) Hydrochloric acid (HCl) Hydrofluoric acid (HF) Nitric acid (HNO3) Perchloric acid (HClO4) Phosphoric acid (H3PO4) Sulfuric acid (H2SO4) Ammonium hydroxide ... be calculated 30.2 Summary of Test Method—Determine the percent of free water, LOI, CO2, SO3, CaO, and MgO in accordance with the preceding sections Calculate combined H2O, calcium carbonate, calcium ... introduction of traces of organic matter due to the action of the hot sulfuric acid on the paper; these would consume KMnO4 and give high results for CaO 17.5 Calculation—Calculate the percentage of CaO...
... curvature, grind the face or faces to plane surfaces or discard the specimen A periodic check of the cross-sectional area of the specimens should be made NOTE 7—Specimen Faces—Results much lower than ... specimens in water at a temperature of 73.56 3.5°F or [23 2 C] and of sufficient depth to completely immerse each specimen until time of testing 10.6.2 Wipe each specimen to a surface-dry condition, ... head of the machine The center of the sphere shall lie at the center of the surface of the block in contact with the specimen The block shall be closely held in its spherical seat, but shall be...
... Mixing of Mortars—Mix the mortar in accordance with the procedure for mixing pastes in Practice C 305 13.3.3 Determination of Flow—Determine the flow in accordance with the Procedure section of Test ... 20 C; variations from this temperature produce inaccuracy in the hydrometer reading; (2) Speci c gravity: Addition of dispersant changes the speci c gravity of the solution; (3) Meniscus correction: ... method covers the determination of the speci c gravity of hydrated lime The speci c gravity of hydrated lime is needed for calculations of air content (see Section 13) and Blaine Surface Area 21 Commercially...
... it through a cheap desiccant, such as calcium chloride or sulfuric acid, followed by a desiccant of high efficiency, such as magnesium perchlorate or anhydrous calcium sulfate, with care taken ... If desired calculate the percentage of CaO corrected for SrO as follows: CaOc % CaOi % 0.54 SrO % (5) where: CaOc CaO corrected for SrO, and CaOi initial CaO as determined in 13.4.1 CaO 56.08 ... Reagent Chemicals, American Chemical Society Specifications, American Chemical Society, Washington, DC For suggestions on the testing of reagents not listed by the American Chemical Society, see...
... sufficient water to give a paste of normal consistency in accordance with the procedure described in Test Method C 187 Mix this batch in accordance with the procedure described in Practice C 305 ... humidity of the moist storage facilities to the requirements of Specification C 511 Preparation of Test Specimens 9.1 Mixing Cement Paste—Prepare the standard batch consisting of 650 g of cement ... C 151 requirements of Practice C 490 except that molds need not be sealed humidity of the molding room within the limits of Practice C 490 5.2 Moist Storage Facilities—Maintain...
... Specification C 1005 Evaluate the weighing device for precision and accuracy at a total load of kg 5.6 Glass Graduates—Glass graduates of 250-mL capacity, conforming to the requirements of Specifications ... Standard Sand 7.1 Use sand conforming to the requirements of Specification C 778 for 20–30 sand Sampling 8.1 Sample the cement in accordance with Practice C 183 Procedure 9.1 Batch—Proportion the standard ... the mortar in accordance with Practice C 305 9.3 Flow Determination—Carefully wipe dry the flow-table top and place the flow mold at the center of it Using the spoon, place a layer of mortar about...
... few light touches of the pointed end of the trowel During these operations of cutting and smoothing, take care not to compress the paste 6.3 Consistency Determination—Center the paste confined in ... the plunger end Cof which shall be brought in contact with the surface of the paste, and tighten the set-screw E Then set the movable indicator F to the upper zero mark of the scale, or take an ... original surface in 30 s after being released Make trial pastes with varying percentages of water until the normal consistency is obtained Make each trial with fresh cement Calculation 7.1 Calculate...