0

walter lucy c 1630 1658 welsh mistress of charles ii

Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object

Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object

Kỹ thuật lập trình

... c u tr c tr c C cc s d ng: ng: Khai báo l p (file h): t o ki u cho đ i tư ng ng class p> { ; tính>; ; c> ; }; C i đ t l p (file cpp): c i ... Nguy n Minh Huy 13 T mv c Dr Guru khuyên: khuyên: Quy t c h p đen: đen: Thu c tính c t m v c private đ h n ch truy xu t t Phương th c có t m v c public đ cung c p tính năng class PhanSo { private: ... ng l p Đ i tư ng gì? gì? Chương trình c máy” ph c t p máy” p C u thành t nhi u lo i “chi ti t” t” Chi ti t b n: hàm, c u tr c n: hàm, tr c Đã đ t o chương trình t t? t? Chi ti t m i: Đ i tư ng!!...
  • 22
  • 538
  • 5
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Báo cáo khoa học

... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because ... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6]...
  • 8
  • 616
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Báo cáo khoa học

... functionality of Cre or FLP recombination targets in genomic manipulation constructs Nucleic Acids Res 24, 3118–3119 ¨ 17 Lorbach, E., Christ, N., Schwikardi, M & Droge, P (2000) Sitespeci c recombination ... recombination in cell line TRE2/3 which contains a single copy of the vector The analysis was performed in the absence of doxycyclin, i.e the TRE-CMV promoter is active and transcription proceeds ... amount of gd102NLS is present in CHO cells throughout the time course of our experiments [10], neither changes in chromatin structure occurring during the cell cycle nor the passage of a replication...
  • 7
  • 472
  • 0
Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Báo cáo khoa học

... the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ ... a cDNA clone corresponding to the 3¢-end of human MUC5AC inserted into a pBluescript vector, was used as a template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ ... part of the figure Dimer, dimeric M-MUC5AC-CH; Monomer, monomeric M-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- terminal cleavage fragment; M -C1 , N-terminal cleavage fragment The position of...
  • 9
  • 330
  • 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

Báo cáo khoa học

... insertion of a linker sequence formed by the oligonucleotides ZlibHisStop-1: 5¢-TCGACCCATCAT CATCATCATCATTAATAAGTCGAC-3¢ and ZlibHisStop-2: 5¢-TCGACGTCGACTTATTAATGATGATGA TGATGATGATGGG-3¢ encoding ... reference surface (ABD) was used to produce subtractive sensorgrams IgA-speci c affibody ligands (Eur J Biochem 269) 2649 Construction and production of dimeric (head-to-tail) affibody constructs The ... therapeutic use are currently under investigation in clinical trials [34] The majority of those are of IgG isotype, which can effectively activate complement- and antibodydependent cellular cytotoxicity...
  • 9
  • 579
  • 0
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

Báo cáo khoa học

... aI22 3C ⁄ cV5 8C aI22 3C ⁄ cL5 9C aN23 0C ⁄ cS6 6C aN23 0C ⁄ cT6 7C aN23 0C ⁄ cG6 8C aN23 0C ⁄ cI6 9C aN23 0C ⁄ cY7 0C aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C ... aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C aL24 0C ⁄ cI7 7C aL24 1C ⁄ cL7 6C aL24 1C ⁄ cI7 7C aL20 7C ⁄ cF5 4C aL20 7C ⁄ cI5 5C aN21 4C ⁄ cA6 2C aN21 4C ⁄ cI6 3C aN21 4C ... cI6 3C aN21 4C ⁄ cP6 4C aN21 4C ⁄ cM6 5C aN21 4C ⁄ cI6 6C aA21 7C ⁄ cM6 5C aA21 7C ⁄ cI6 6C aI22 1C ⁄ cG6 9C aI22 3C ⁄ cL7 2C aI22 3C ⁄ cY7 3C aL22 4C ⁄ cL7 2C aL22 4C ⁄ cY7 3C aI22 5C ⁄ cL7 2C aI22 5C ⁄ cY7 3C ++++ +++...
  • 14
  • 592
  • 0
SEFYDLIAD ASTUDIAETHAU GWLEDIG CYMRU WELSH INSTITUTE of RURAL STUDIES : ORGANIC POULTRY PRODUCTION potx

SEFYDLIAD ASTUDIAETHAU GWLEDIG CYMRU WELSH INSTITUTE of RURAL STUDIES : ORGANIC POULTRY PRODUCTION potx

Nông nghiệp

... at an acceptable price • the supply of product at a price acceptable to the consumer • the removal of uncertainty concerning future organic livestock standards and regulations ix ORGANIC POULTRY ... by-products The results of these two scenarios are shown in each of the following tables and the consequences discussed in the conclusion to this section In some cases, the consequences of restricting ... presence of cocks is not strictly necessary, even though some people have argued that the presence of approximately one cock for every 30 hens can have a calming effect (Fölsch, 1986) One organic...
  • 99
  • 172
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học

... and LPS -II (lane 2) of C braakii PCM 1531, LPS of Citrobacter PCM 1504 (lane 3), LPS of Citrobacter PCM 1505 (lane 4) and LPS of Citrobacter PCM 1487 (lane 5) LPS-I) and OPS -II (from LPS -II) were ... O-polysaccharide from Citrobacter braakii O6 (Eur J Biochem 270) 2735 Fig Part of a two-dimensional 1H,1 3C HSQC spectrum of the O-speci c polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional ... residue of Rha at the branching point Elucidation of the structure of the O-speci c polysaccharide by NMR spectroscopy The 1 3C NMR spectra of OPS-I and OPS -II were essentially identical, and...
  • 7
  • 478
  • 0
Animesh Ranjan 5101045 C-2 (biotechnology) Jaypee Institute of Information Technology pptx

Animesh Ranjan 5101045 C-2 (biotechnology) Jaypee Institute of Information Technology pptx

Cao đẳng - Đại học

... academic as well as practical exposure and we look forward to more of such visits in future to enhance both our theoretical, technical and practical knowledge Alcoholic Beverages An alcoholic ... The consumption of alcohol is often important at social events in such societies and may be an important aspect of a community's culture The concentration of alcohol in a drink may be specified ... Danish scientist Hansen Nowadays there are two main varieties of yeasts that are used in brewing: saccharomyces cerevisiae and saccharomyces carlsbergensis (bottomfermenting) Certain other products...
  • 20
  • 323
  • 0
egbers c., pfister g. (eds.) physics of rotating fluids

egbers c., pfister g. (eds.) physics of rotating fluids

Vật lý

... include the C+ and C coalescence points and quartic bifurcation points which can occur at certain singularities of the system (32) Extended systems for these singularities may be found in Cliffe ... of experience guarantee authors the best possible service To reach the goal of rapid publication at a low price the technique of photographic reproduction from a camera-ready manuscript was chosen ... should check the contributions for the correct use of language At Springer-Verlag only the prefaces will be checked by a copy-editor for language and style Grave linguistic or technical shortcomings...
  • 445
  • 774
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Hóa học - Dầu khí

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... domain II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...
  • 12
  • 354
  • 0
Designation: C 25 – 99 - Chemical Analysis of Limestone, Quicklime, and Hydrated Lime1 pptx

Designation: C 25 – 99 - Chemical Analysis of Limestone, Quicklime, and Hydrated Lime1 pptx

Kiến trúc - Xây dựng

... concentrations are intended: Acetic acid (HC2H3O2) Hydrochloric acid (HCl) Hydrofluoric acid (HF) Nitric acid (HNO3) Perchloric acid (HClO4) Phosphoric acid (H3PO4) Sulfuric acid (H2SO4) Ammonium hydroxide ... be calculated 30.2 Summary of Test Method—Determine the percent of free water, LOI, CO2, SO3, CaO, and MgO in accordance with the preceding sections Calculate combined H2O, calcium carbonate, calcium ... introduction of traces of organic matter due to the action of the hot sulfuric acid on the paper; these would consume KMnO4 and give high results for CaO 17.5 Calculation—Calculate the percentage of CaO...
  • 36
  • 692
  • 1
Designation: C 109/C 109M – 99 - Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)1 pps

Designation: C 109/C 109M – 99 - Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)1 pps

Kiến trúc - Xây dựng

... curvature, grind the face or faces to plane surfaces or discard the specimen A periodic check of the cross-sectional area of the specimens should be made NOTE 7—Specimen Faces—Results much lower than ... specimens in water at a temperature of 73.56 3.5°F or [23 2 C] and of sufficient depth to completely immerse each specimen until time of testing 10.6.2 Wipe each specimen to a surface-dry condition, ... head of the machine The center of the sphere shall lie at the center of the surface of the block in contact with the specimen The block shall be closely held in its spherical seat, but shall be...
  • 6
  • 487
  • 2
Designation: C 110 – 00 - Physical Testing of Quicklime, Hydrated Lime, and Limestone1 doc

Designation: C 110 – 00 - Physical Testing of Quicklime, Hydrated Lime, and Limestone1 doc

Kiến trúc - Xây dựng

... Mixing of Mortars—Mix the mortar in accordance with the procedure for mixing pastes in Practice C 305 13.3.3 Determination of Flow—Determine the flow in accordance with the Procedure section of Test ... 20 C; variations from this temperature produce inaccuracy in the hydrometer reading; (2) Speci c gravity: Addition of dispersant changes the speci c gravity of the solution; (3) Meniscus correction: ... method covers the determination of the speci c gravity of hydrated lime The speci c gravity of hydrated lime is needed for calculations of air content (see Section 13) and Blaine Surface Area 21 Commercially...
  • 19
  • 432
  • 0
Designation: C 114 – 00 - Chemical Analysis of Hydraulic Cement1 pot

Designation: C 114 – 00 - Chemical Analysis of Hydraulic Cement1 pot

Kiến trúc - Xây dựng

... it through a cheap desiccant, such as calcium chloride or sulfuric acid, followed by a desiccant of high efficiency, such as magnesium perchlorate or anhydrous calcium sulfate, with care taken ... If desired calculate the percentage of CaO corrected for SrO as follows: CaOc % CaOi % 0.54 SrO % (5) where: CaOc CaO corrected for SrO, and CaOi initial CaO as determined in 13.4.1 CaO 56.08 ... Reagent Chemicals, American Chemical Society Specifications, American Chemical Society, Washington, DC For suggestions on the testing of reagents not listed by the American Chemical Society, see...
  • 30
  • 876
  • 1
Designation: C 151 – 00 - Autoclave Expansion of Portland Cement1 pptx

Designation: C 151 – 00 - Autoclave Expansion of Portland Cement1 pptx

Kiến trúc - Xây dựng

... sufficient water to give a paste of normal consistency in accordance with the procedure described in Test Method C 187 Mix this batch in accordance with the procedure described in Practice C 305 ... humidity of the moist storage facilities to the requirements of Specification C 511 Preparation of Test Specimens 9.1 Mixing Cement Paste—Prepare the standard batch consisting of 650 g of cement ... C 151 requirements of Practice C 490 except that molds need not be sealed humidity of the molding room within the limits of Practice C 490 5.2 Moist Storage Facilities—Maintain...
  • 3
  • 283
  • 0
Designation: C 185 – 01 - Air Content of Hydraulic Cement Mortar1 ppsx

Designation: C 185 – 01 - Air Content of Hydraulic Cement Mortar1 ppsx

Kiến trúc - Xây dựng

... Specification C 1005 Evaluate the weighing device for precision and accuracy at a total load of kg 5.6 Glass Graduates—Glass graduates of 250-mL capacity, conforming to the requirements of Specifications ... Standard Sand 7.1 Use sand conforming to the requirements of Specification C 778 for 20–30 sand Sampling 8.1 Sample the cement in accordance with Practice C 183 Procedure 9.1 Batch—Proportion the standard ... the mortar in accordance with Practice C 305 9.3 Flow Determination—Carefully wipe dry the flow-table top and place the flow mold at the center of it Using the spoon, place a layer of mortar about...
  • 3
  • 317
  • 0
Designation: C 187 – 98 - Normal Consistency of Hydraulic Cement1 pptx

Designation: C 187 – 98 - Normal Consistency of Hydraulic Cement1 pptx

Kiến trúc - Xây dựng

... few light touches of the pointed end of the trowel During these operations of cutting and smoothing, take care not to compress the paste 6.3 Consistency Determination—Center the paste confined in ... the plunger end C of which shall be brought in contact with the surface of the paste, and tighten the set-screw E Then set the movable indicator F to the upper zero mark of the scale, or take an ... original surface in 30 s after being released Make trial pastes with varying percentages of water until the normal consistency is obtained Make each trial with fresh cement Calculation 7.1 Calculate...
  • 2
  • 414
  • 0

Xem thêm