vi phương pháp học tập bộ môn tt
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
... previously described methods [15] Primers for gene analysis in this study have been described previously [15–18] We determined transcript levels of: mCPT1, the rate-limiting mitochondrial fatty ... to play an important role in this process, and is proposed to signal its cardioprotection via the prosurvival kinase Akt [2,4] For example, higher levels of activated Akt were reported in premenopausal ... glucose is a more oxygen-efficient fuel substrate for the generation of ATP as compared to fatty acids Also, fatty acid-mediated uncoupling of mitochondrial oxidative phosphorylation may result in diminished...
- 7
- 582
- 0
báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf
... school children using scoliosis screening Only individuals suspected of having scoliosis undergo a radiograph, and therefore the distribution patterns of side curvature and the average curves of ... There was no significant difference in curvature pattern between adolescent and adult group There was no significantly difference in the curvature pattern between male and female in adolescent and ... negative value The curve pattern was organized in each collective three groups: neutral (from -1 degree to degree), right (> +1 degree), and left (< -1 degree) The curvature pattern difference in each...
- 5
- 353
- 0
báo cáo hóa học:" Right thoracic curvature in the normal spine" docx
... school children using scoliosis screening Only individuals suspected of having scoliosis undergo a radiograph, and therefore the distribution patterns of side curvature and the average curves of ... There was no significant difference in curvature pattern between adolescent and adult group There was no significantly difference in the curvature pattern between male and female in adolescent and ... negative value The curve pattern was organized in each collective three groups: neutral (from -1 degree to degree), right (> +1 degree), and left (< -1 degree) The curvature pattern difference in each...
- 5
- 261
- 0
Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt
... experimentally, via simulation, and using the developed models It was shown that via multi-scale modeling of the spatiotemporal locality of on-body link disconnection patterns, it is possible to attain better ... of Health and Human Services,” http://grants2.nih.gov/grants/guide/pa-files/PA-07-354.html [4] K Y Chen and D R Bassett Jr., “The technology of accelerometry-based activity monitors: current and ... Chipcon’s SmartRF CC1000 radio chip (http://www.chipcon.com/), and the sensor card MTS510 from Crossbow Inc (http://www.xbow.com/) The Mica2Dot nodes run from a 570 mAH button cell with a total sensor...
- 19
- 351
- 0
Báo cáo hóa học: " On the Compensation of Delay in the Discrete Frequency Domain" pot
... “Adaptive equalisation in oversampled subbands,” IEE Electronics Letters, vol 34, no 15, pp 1452–1453, 1998 [12] A Gilloire and M Vetterli, “Adaptive filtering in subbands with critical sampling analysis, ... example to illustrate the limitations of the DFT filterbank FDAF A source signal s(n) is transmitted over a channel and is received as x(n) A delayed version of s(n) is available as a desired ... of the magnitude and phase within a filterbank bin is not sufficient to perfectly achieve any nontrivial delay In this paper, we present an analysis to quantitatively determine the degree to which...
- 11
- 309
- 0
Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx
... placement of an in vivo videomicroscope (epi-objective microscope with epi-illumination, Olympus Model BXFM; (Olympus America Inc Melville, NY USA) At each timepoint, the apparatus was reattached to ... depth of field of our in vivo microscope Likewise, bag-like folding and unfolding of the alveolus would be in the third dimension, invisible to our in vivo microscopic view Regardless of the mechanism, ... problems with our in vivo microscopic technique, it is the only tool available to directly observe the behavior of alveoli in a living animal Utilizing electron microscopy, we have previously confirmed...
- 9
- 277
- 0
Báo cáo y học: "Morphological characterisation of portal myofibroblasts and hepatic stellate cells in the normal dog liver" pptx
... large individual differences, presumptive vitamin A-storing HSC were regularly seen with a single large vacuole (vitamin A-storing lipid droplet) and a dislocated nucleus HSC without a vitamin ... purposes) Comparative Hepatology 2006, 5:7 1a http://www.comparative-hepatology.com/content/5/1/7 1b Figure Vimentin Vimentin Normal canine liver, stained with vimentin antibody a) In the portal area, ... due to interspecies crossreactivity All antibodies have been used previously in multiple other canine studies [20-26] Variation in vimentin and desmin staining pattern was widely present This...
- 9
- 284
- 0
Báo cáo y học: " Cardiac effects of induction agents in the septic rat heart" potx
... far not been systematically compared in a dose-dependent fashion There is very little evidence on the direct in vitro effects of these agents on cardiac contractile function in sepsis, and the ... J, Ranieri M, Ramsay G, Sevransky J, Thompson BT, Townsend S, Vender JS, Zimmerman JL, Vincent JL: Surviving Sepsis Campaign: international guidelines for management of severe sepsis and septic ... to mg/kg xylazine hydrochloride A polymicrobial sepsis was induced via cecal ligation and a single puncture as reported previously in detail [12] After 20 hours of incubation, hearts were isolated...
- 8
- 286
- 0
Tài liệu IN THE HEART OF AFRICA pptx
... tribe—Thieving elephants CHAPTER VI CHAPTER VI Preparations for advance—Mek Nimmur makes a foray—The Hamran elephant-hunters—In the haunts of the elephant—A desperate charge CHAPTER VII CHAPTER VII ... XIV CHAPTER XV CHAPTER XVI CHAPTER XVII CHAPTER XVIII CHAPTER XIX CHAPTER XX CHAPTER XXI CHAPTER XXII CHAPTER XXIII CONTENTS CHAPTER I CHAPTER I The Nubian desert—The bitter well—Change of plans—An ... rascal in Central Africa—Legge demands another bottle CHAPTER XVI CHAPTER XVI The greeting of the slave-traders—Collapse of the mutiny—African funerals-Visit from the Latooka chief—Bokke makes a suggestion—Slaughter...
- 219
- 335
- 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
... mutagenic forward primers were used: Y286A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â ... Herndon, VA, USA) supplemented with 10% fetal bovine serum (Lonza, Walkersville, MD, USA), 100 UặmL)1 penicillin and 100 lgặmL)1 streptomycin (Lonza, Walkersville, MD, USA) 293T cells (obtained from ... retroviral expression vectors Mutant and WT Cx43eYFP fusion constructs were amplied using the following adapter primers containing ClaI sites (underlined): 5Â-GATCATATCGATACAGCAGCGGAG TTT-3Â...
- 14
- 433
- 0
The French in the Heart of America doc
... Talon the intendant, that Marquette should join him or he Marquette upon this voyage of discovery, so consonant with Marquette's desire for divine ordering Marquette quieted his morbid conscience, ... until it has settled, when it is no better than that of the Ohio, for example If you let a pint of it settle you will have three-fourths of an inch of mud in the bottom His advice is to keep ... battle of the shoals, a battle in which General Eads, who had bridged the river at St Louis, compelled the river by means of jetties to run deeper and carry heavier burdens But the future battle-fields...
- 160
- 497
- 0
báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx
... Outcomes 2010, 8:14 http://www.hqlo.com/content/8/1/14 Background Medical progress has lead to increased survival, as a result a progressively increasing number of patients are living with congenital ... through focus groups, cognitive interviews, pretesting, and field testing measurement development protocols Cognitive interviews were carried out with children attending the pediatric cardiology ... Generic Core Scales: Sensitivity, responsiveness, and impact on clinical decisionmaking Journal of Behavioral Medicine 2002, 25:175-193 16 Varni JW, Burwinkle TM, Jacobs JR, Gottschalk M, Kaufman M,...
- 12
- 619
- 2
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc
... distemper virus in phocids Journal of Wildlife Diseases 2004, 40:53-59 Appel MJG: Reversion to virulence of attenuated canine distemper virus in vivo and in vitro Journal of General Virology 1978, ... ("strains") The viruses from year 2001 formed syncytia in vivo and in vitro Previously, an inverse relationship between the proficiency of syncytium formation and the level of CDV virulence was ... the 2001 viruses, which formed large syncytia in vivo and in vitro However, past notions concerning the inverse relationship between fusogenicity and virulence may be imprecise Indeed, virulent...
- 14
- 346
- 0
báo cáo hóa học:" Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" pot
... distemper virus in phocids Journal of Wildlife Diseases 2004, 40:53-59 Appel MJG: Reversion to virulence of attenuated canine distemper virus in vivo and in vitro Journal of General Virology 1978, ... ("strains") The viruses from year 2001 formed syncytia in vivo and in vitro Previously, an inverse relationship between the proficiency of syncytium formation and the level of CDV virulence was ... the 2001 viruses, which formed large syncytia in vivo and in vitro However, past notions concerning the inverse relationship between fusogenicity and virulence may be imprecise Indeed, virulent...
- 14
- 397
- 0
báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc
... instrument is desirable since this may provide additional evidence not only on the limitations of the HADS, but also the development, enhancement and possible future revision of this widely used measure ... Hong Kong has also furnished compelling evidence for the tri-dimensionality of the HADS Hong Kong Chinese invariably speak Cantonese whereas in the Xi'an province of China Mandarin is spoken Due ... 4:6 http://www.hqlo.com/content/4/1/6 Table 1: Characteristics of each factor model tested Model Zigmond and Snaith (1983) Moorey et al (1991) Dunbar et al (2000) Friedman et al (2001)* Razavi...
- 5
- 392
- 0
báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf
... while sensitivity to change seems to be influenced by the type of intervention The SF-6D has better distributional properties than the EQ-5D, but that did not result in improved sensitivity to change ... within each trial http://www.hqlo.com/content/4/1/20 health domains: pain (6 levels), mental health (5), physical functioning (6), social functioning (5), role limitations (4) and vitality (5) The ... usual activities; PD: pain/discomfort; AD: anxiety/ depression SF-6D dimensions: PF: physical functioning; RL: role limitation; SF: social functioning; PN: pain; MH: mental health; VT: vitality...
- 9
- 408
- 0
báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx
... exercise time (ETT), Canadian Cardiovascular Society Angina Classification (CCS) and the Seattle Angina Questionnaire (SAQ), are generally gathered Such variables would be obvious candidates ... Goldsmith et al Health and Quality of Life Outcomes 2010, 8:54 http://www.hqlo.com/content/8/1/54 this base model ETT, CCS class and individual SAQ scales were each added in a stepwise fashion to ... observed values Standardised residuals and fitted EQ-5D index values from fitting the final model in both the estimation and validation datasets were plotted against one another A Bland-Altman analysis...
- 13
- 334
- 0
Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx
... of attraction of the normal law, we will show that the ASCLT holds under a fairly general growth condition on dk = k−1 exp(ln k)α ), ≤ α < 1/2 Our theorem is formulated in a more general setting ... theorem Statist Probab Lett 9, 201–205 (1990) [5] Ibragimov, IA, Lifshits, M: On the convergence of generalized moments in almost sure central limit theorem Stat Probab Lett 40, 343–351 (1998) 11 ... rmann, S: Critical behavior in almost sure central limit theory J Theoret Probab 20, 613–636 (2007) o [9] Wu, QY: Almost sure limit theorems for stable distribution Stat Probab Lett 281(6), 662–672...
- 13
- 480
- 0
Báo cáo hóa học: " Some nonlinear delay integral inequalities on time scales arising in the theory of dynamics equations" ppt
... left-scattered if r(t) < t and right-scattered if s(t) >t Definition 1.2: The set T is defined to be T if T does not have a left-scattered maximum, otherwise it is T without the left-scattered ... Feng et al Journal of Inequalities and Applications 2011, 2011:29 http://www.journalofinequalitiesandapplications.com/content/2011/1/29 Page of 14 A time scale is ... some t Î T, and a function f Î (T, R), the delta derivative of f at t is denoted by fΔ(t) (provided it exists) with the property such that for every ε > 0, there exists a neighborhood U of t...
- 14
- 418
- 0
Emergency Duties and Deaths from Heart Disease among Firefighters in the United States docx
... risks, 37 U.S states and Canadian provinces provide benefits to firefighters in whom certain cardiovascular diseases have developed.14 Nevertheless, the evidence linking firefighting to cardiovascular ... important questions The findings in our previous case–control study of 52 deaths from coronary heart disease among on-duty firefighters provided preliminary evidence that coronary events may be triggered ... 2001, terrorist attacks To extract study data, two reviewers independently examined the summary of each reported death that occurred while the firefighter was on duty A third reviewer resolved...
- 10
- 327
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008