value of a statistical case for three illnesses and different cessation lags
Báo cáo y học: " The value of a risk model for early-onset candidemia" ppt
... Molina FJ, BlascoNavalproto MA, López MJ, Charles PE, Martín E, Hernández-Viera MA: Usefulness of the ‘Candida score’ for discriminating between Candida colonization and invasive candidiasis ... In bacterial bloodstream infections and pneumonia, early identification of those at risk for multidrug-resistant organisms can lead to early appropriate therapy, and thus to a lower mortality ... candidemia, studies have show that delayed therapy can lead to a higher mortality in hospitalized patients with late candidemia [11] Early identification of these patients therefore becomes paramount...
- 2
- 304
- 0
Establishment and characterization of a murine model for allergic dermatitis and asthma using dermatophagoides mite allergens
... spontaneous airway hyperresponsiveness, airway inflammation and airway remodeling, features of acute and chronic asthma that resembled human asthma, and these pathological changes could be adoptively ... (Ramb-Lindhauer C et al., 1991; van Reijsen FC et al., 1992) Animal Dander and Cockroach Allergens Animal dander and cockroach allergens have been studied in association with asthma and allergic ... Nigeria for the 13 to 14 year age range High prevalence values for atopic ezema symptoms (above 15%) were found in urban Africa, the Baltics, Australasia and Northern and Western Europe at both ages...
- 222
- 433
- 0
báo cáo hóa học:" Predictive value of ovarian stroma measurement for cardiovascular risk in polycyctic ovary syndrome: a case control study" pptx
... (Table 3) Analysis of the ultrasound appearance of the ovaries showed that PCOS patients showed had a higher ovarian and stromal volume, stromal area and a higher area stromal area/area ovary ... a 6.5 MHz transvaginal transducer (Aloka ALPHA 10 PROSOUND (Aloka, Tokyo, Japan): ovarian volume, ovarian area, stromal area, S /A ratio and the number, diameters and distribution of follicles ... the statistical analysis CL have made substantial contributions to acquisition of data, AMC have made substantial contributions to interpretation of data All authors read and approved the final...
- 7
- 422
- 0
Báo cáo hóa học: "Setup, efforts and practical experiences of a monitoring program for genetically modified plants - an Austrian case study for oilseed rape and maize" pptx
... http://www.eea europa.eu/data -and- maps/data/eea-reference-grids which is used as the standard reference grid for all spatial statistic data in Austria Hence, we have a direct spatial link between our BINATS ... feral B napus, B nigra, feral B oleracea, wild and feral B rapa, Conringia austriaca, C orientalis, Crambe tatarica, Diplotaxis muralis, D tenuifolia, Eruca sativa, Erucastrum gallicum, E nasturtiifolium, ... types, climatic conditions and management regimes of a country; (2) baseline data necessary for detecting changes in the abundance and diversity of plants and animals as well as in habitat structures...
- 12
- 497
- 0
Báo cáo y học: "Oberlin partial ulnar nerve transfer for restoration in obstetric brachial plexus palsy of a newborn: case report" pot
... the patient in this case had had phrenic nerve palsy and an operation had already been performed Intracostal nerve transfer for a patient with phrenic nerve palsy is a danger because a respiratory ... recovery of the biceps and deltoid muscles Under general anesthesia, an operation was performed in the supine position The brachial artery and the median, ulnar, and a branch of the musculocutaneous ... suggesting that primary surgical repair of the brachial plexus was warranted if recovery of the biceps had not began at three to four months of age, because in such cases functional prognosis was considered...
- 5
- 371
- 0
Báo cáo y học: "Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pptx
... current care and optimal care [4] An important part of the diagnostic analysis is the identification of barriers and facilitators to change Until now, studies identifying barriers and facilitators ... guideline for breast cancer surgery in day care is a complex process that involves changes on the organizational and management level, as well as the level of health care professionals and patients ... manuscript, the acquisition, and interpretation of data, and has been involved in drafting and critically revising the manuscript for important intellectual content All authors have read and approved...
- 12
- 398
- 1
Báo cáo y học: " Patterns of treatment seeking behavior for mental illnesses in Southwest Ethiopia: a hospital based study" docx
... were fluent in Afaan Oromo and Amharic languages (local languages) The questionnaire was adopted from World health organization encounter form for Pathways to care [15] and items that assess the ... delayed Data was checked for completeness and consistency and analyzed using SPSS16 statistical software Descriptive statistics were presented using summary tables and graphs Cross-tabulations and ... mental illness at home A study also showed that less than half of mental illness patients directly contacted a mental hospital, and the median delay between onset of illness and arrival at the...
- 7
- 354
- 0
báo cáo khoa học: " Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pot
... current care and optimal care [4] An important part of the diagnostic analysis is the identification of barriers and facilitators to change Until now, studies identifying barriers and facilitators ... guideline for breast cancer surgery in day care is a complex process that involves changes on the organizational and management level, as well as the level of health care professionals and patients ... manuscript, the acquisition, and interpretation of data, and has been involved in drafting and critically revising the manuscript for important intellectual content All authors have read and approved...
- 12
- 483
- 0
Báo cáo y học: "A multicentre case-control study of nonsteroidal anti-inflammatory drugs as a risk factor for severe sepsis and septic shock" docx
... and standard interviews were conducted by physicians An exhaustive list of all oral and parenteral NSAIDs (including their international nonproprietary name and brand name) was provided to each ... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (
- 7
- 467
- 0
Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... 12 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for...
- 9
- 372
- 0
Báo cáo y học: "Protein-lipid interactions: correlation of a predictive algorithm for lipid-binding sites with three-dimensional structural data" ppt
... actin in yeast: biochemical mechanism and physiological relevance J Cell Biol 2004, 164:567-80 Yamashita A, Maeda K, Maeda Y: Crystal structure of CapZ: structural basis for actin filament barbed ... the intact rod implies a relatively weak attraction between alphaactinin and negatively charged phospholipids in the absence of neutralizing cofactors or a significant conformational change Surprisingly, ... subdomains and of Arp2 are weak, preventing accurate refinement of this region, the three- dimensional coordinates available from the Protein Data Bank are a synthesis of refined structure and molecular...
- 14
- 244
- 0
Báo cáo y học: "A statistical method for predicting splice variants between two groups of samples using GeneChip® expression array data" pps
... expression array data We illustrated the method using empirical data from normal cerebellum, metastatic medulloblastoma and non-metastatic medulloblastoma samples We predicted a total of 577 alternatively ... et al and compared the splice variants predicted from the two approaches Our dataset consists of normal cerebellum, non-metastatic medulloblastomas, and metastatic medulloblastomas The comparisons ... difference A negative Z-score means a lower expression in metastatic medulloblastomas than in non-metastatic medulloblastomas, and vice-versa for a positive Z-score Page of Affy Probe Set ID (page number...
- 9
- 293
- 0
Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx
... inheritance In this model a monogenic component is added to the assumed polygenic variation When two alleles A and a are segregating at a major locus, three genotypes are possible (AA, Aa, aa) which ... Tables I to IV show the main characteristics of the distributions of the test statistics: mean, standard deviation, 5% and 1% empirical quantiles and percentage of replicates beyond the 5% and ... (number of sires) allowing some extrapolations for higher values of this number - Finally, the jackknife standard deviation of the estimated quantile varies, for the 5% case, between 0.23 and 0.89,...
- 17
- 352
- 0
Development of a robotic nanny for children and a case study of emotion recognition in human robotic interaction
... pre-specified tasks to assist nurses and teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce ... the authors evaluated its generalization ability on another two databases: 31 MMI database and JAFFE database The accuracy rates about basic expressions and neutral expression are only 51.1% for ... entertainment, healthcare, childcare, education, and therapy areas Since many factors such as target environment, gender and age information, cultural and social background, and health status a ect the...
- 172
- 452
- 0
A statistical argument for the homophony avoidance approach to the disyllabification of chinese
... the framework of corpus based study The study will be based on the corpora of Mandarin, Cantonese, American English, Japanese and Hawaiian Among these five languages, Japanese and Hawaiian are ... in Japanese (Tamaoka and Makioka 1987), which is far away from that in American English; and Hawaiian has the simplest syllable structure among these three languages ( See WALS for a comparison) ... known as languages with a few syllable types; Mandarin and Cantonese are the language with a moderate number of syllable types; American English has a large number of syllable types The HA approach...
- 58
- 375
- 0
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt
... information are advised and encouraged to confirm specific claims for product performance as necessary and appropriate The legal/financial materials and information that are available for reference ... a rapidly rising wave of new and stored digital information The massive proliferation of data creates ever−expanding digital information risks for organizations and individuals Electronic information ... takes a critical "leap of faith" on the part of the auditor/security professional: that the organization does indeed maintain an e−mail log/file and also archives all e−mail traffic Additionally,...
- 346
- 1,530
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg...
- 9
- 497
- 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx
... student how to fit up and adapt apparatus for his daily work, and how to carry out thoroughly and systematically the various bacterioscopical analyses that are daily demanded of the bacteriologist by ... use are: Chemical Reagents.—Disinfectants (for the disinfection of glass and metal apparatus and of morbid tissues) Physical Agents HEAT.— (a) Dry Heat: Naked flame (for the sterilisation of platinum ... furnace (for the sterilisation of filter candles, and for the destruction of morbid tissues) Hot air (for the sterilisation of all glassware and of metal apparatus) (b) Moist Heat: Water at 56°...
- 666
- 511
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... data and reference data The NEWS10 data consists of pairs of titles of the same Wikipedia pages written in different languages, which may be transliterations or translations The seed data is a...
- 9
- 521
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25