use prtvtoc to print the partition table you just created and save its output to a file in
báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx
... data analysis and drafted the manuscript CS conducted data analysis and helped to draft the manuscript LP participated in study design, data collection and analysis, and helped to draft the manuscript ... Clinical reminders about required screenings and other tasks initially appear in the EHR when a patient arrives in the clinic and a nurse administers an initial screening When the primary care ... implementation and the value added to the organization by the EHR Participants’ recommendations may help healthcare administrators anticipate barriers to EHR implementation and work to address them,...
- 8
- 249
- 0
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx
... response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI is taken up by increased ... such as histamine there is a reflex increase in the frequency and depth of spontaneous sighs, and these DIs cause prompt and nearly complete dilation of the airway [6,13] In studies of the canine ... first undertaken as a rough model of mechanical uncoupling of ASM from the mechanical loads attributable to parenchymal tethering and lung elastic recoil [8] Several laboratories have subsequently...
- 3
- 252
- 0
grid computing esis analysis of its impact on business and the shift to a services infrastructure
... WHAT IS DRAMATICALLY NEW ABOUT ABOUT GRIDS? a a a a GRIDS BEGIN AS A WAY TO ACCELERATE COMPUTING THEY EVOLVE TO A TECHNOLOGY THAT MAKES APPLICATIONS INFRASTRUCTURE AWARE THIS IMBEDS ... multi-purpose protocols and interfaces that address such fundamental issues as authentication, authorization, resource discovery, and resource access – these protocols and interfaces must be standard and ... policy, payment, membership, and so forth that arise in these settings Otherwise, we are dealing with a local management system a Uses standard, open, general-purpose protocols and interfaces –...
- 41
- 212
- 0
Tài liệu Connecting to a Named Instance of SQL Server or Microsoft Data Engine (MSDE) docx
... plus an instance name The format is \ This format is used in the connection string to specify the Data Source attribute for a named instance Each instance operates independently ... independently of the other instances installed on the same computer Each instance has its own set of system and user databases that are not shared between instances and it runs within its own security ... every installed instance of SQL Server Client tools such as Enterprise Manager and Query Analyzer are also shared The System.Data.SqlClient class cannot automatically discover the port number of a...
- 3
- 406
- 0
UCITS Hedge Platform Survey 2012: Building routes to a new investment market place pdf
... depositary and custodian, with Andbanc the administrator “There are quite a number of small start-up fund managers wanting to get a UCITS,” says David Robinson, managing principal and portfolio manager ... well in the setting up and operational phases As a specialist in structuring there is a significant legal/set-up team, a risk team and an operations team to handle pre-trade and post-trade controls ... natural to line up administrators and custodian banks with a presence and understanding of working in Luxembourg “Our long-standing experience in structuring both alternative and traditional investments...
- 17
- 562
- 0
Báo cáo Y học: The function of methyl-menaquinone-6 and polysul®de reductase membrane anchor (PsrC) in polysul®de respiration ofWolinella succinogenes doc
... assumed to be A9 0 mV [reaction (2) in Table 3] The same value is likely to apply for MM in the bacterial membrane, as the Eo of MK in a bacterial membrane was determined to be close to that in organic ... separated by HPLC according to [23] The quinones were quantiđed by HPLC using vitamin K1 as the standard MK4 (Sigma; cat no V-9378) and vitamin K1 (Fluka; cat no 95271) are commercially available ... reduced in the steady state of polysulđde respiration, the amount of MMbH should increase according to reaction (g) as increasing amounts of MM are incorporated into the membrane On the basis of these...
- 10
- 490
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... DNA ligase and Pfx polymerase were from Invitrogen (Burlington, Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained ... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... chromatography (lane 3), preparation after gel filtration (lane 4) The molecular mass of the proteins in the standard (lane 5) are indicated beside the gel that the enzyme adopts an octameric quartenary...
- 9
- 461
- 0
báo cáo hóa học: " Chronic brain inflammation leads to a decline in hippocampal NMDA-R1 receptors" doc
... isoflurane gas and placed in a stereotaxic instrument with the incisor bar set 3.0 mm below the ear bars The scalp was incised and retracted and a hole was made at the appropriate location in the ... oxide and initiate a cascade of reactive oxygen intermediates [34,35] Prostaglandins and various cytokines may also indirectly elevate the extracellular concentration of glutamate by inhibiting its ... performed the receptor binding assay BHW was responsible for the initial characterization of the animal model VRA assisted with the confocal microscopic analyses All authors read and approved the final...
- 9
- 371
- 0
báo cáo hóa học: " The comparative burden of mild, moderate and severe Fibromyalgia: results from a cross-sectional survey in the United States" pdf
... from (indicating no pain) to 10 (indicating pain as bad as you can imagine) Higher scores indicate greater pain severity Based on previous analyses, scores of to are considered mild, to are considered ... was classified as mild, 39 to < 59 was classified as moderate, and 59 to 100 was classified as severe [20] Statistical significance was evaluated at the 0.05 level The data were held and analyzed ... moderate, and 15 to 21 are considered severe To assess pain intensity, subjects were asked to rate their average pain due to FM over the past 24 hours with an 11-point numeric rating scale ranging...
- 13
- 368
- 0
Báo cáo khoa học: "The combination effect of sodium butyrate and 5-Aza-2''''-deoxycytidine on radiosensitivity in RKO colorectal cancer and MCF-7 breast cancer cell lines" pot
... TTAGGTTAGAGGGTTATCGCGT TAACTAAAAATTCACCTACCGAC TAATTTTAGGTTAGAGGGTTATTGT CACAACCAATCAACAACACA M AATTTTTTTATATATATTTTCGAAGC AAAAACCTCAACCCCGCG AATTTTTTTATATATATTTTTGAAGTGT AACAAAAAACCTCAACCCCACA M TTGTTAAAGTGTTGAGTTCGTC ... GATTTTGTTAAAGTGTTGAGTTTGTT CAAAATAATAACAACAATTCCATACA M TGTTGGGGAAGTGTTTTTCGGC CGAAAACGAAACGCCGCG U TAGATGTTGGGGAAGTGTTTTTTGGT TAAATACCCAAAAACAAAACACCACA Page of (page number not for citation purposes) ... genes analyzed in this study Sense primer (5'-3') MINT31(M31) CACAAAAACCCTCACTCACAACAA M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATA M TTAGGTTAGAGGGTTATCGCGT...
- 7
- 327
- 0
Báo cáo y học: "Infiltration of the synovial membrane with macrophage subsets and polymorphonuclear cells reflects global disease activity in spondyloarthropathy" pps
... mAb 1 2A Present or absent vascularity of the sublining layer, infiltration of the sublining layer, and the presence of lymphoid aggregates, plasma cells, and PMNs A separate analysis in 93 samples ... (12 AS, 21 USpA, 24 PsA, inflammatory bowel disease, and reactive arthritis in cluster versus AS, USpA, PsA, and inflammatory bowel disease in cluster 2), indicating the absence of a relation ... histopathology as a biomarker in SpA Despite the fact that lining-layer hyperplasia and inflammatory infiltration with CD163+ macrophages and PMNs reflected the global R367 Arthritis Research & Therapy...
- 11
- 398
- 0
Báo cáo khoa hoc:" Acute jejunoileal obstruction due to a pseudopolyp in a child with undiagnosed crohn disease: A case report" doc
... common manifestation that is the result from both the decreased caloric intake of the inflammatory bowel and Microscopically, edema and diffuse inflammation of the whole intestinal wall, fissures, ... Histological examination throughout the whole intestinal wall Histological examination of the specimen revealed oedema and diffuse inflammation throughout the whole intestinal wall (C,D) Page of (page number ... fissures, granulomas, vascular dilatation, pseudopolyps, mucosal inflammation of the small and large bowel, and granulomas in local lymph nodes were observed The tip of the appendix was inflamed too...
- 3
- 271
- 0
Báo cáo y học: " Solitary metastatic adenocarcinoma of the sternum treated by total sternectomy and chest wall reconstruction using a Gore-Tex patch and myocutaneous flap: a case report" docx
... pulmonary metastasis and distant skeletal disease found in their study was attributed to the drainage of the internal mammary nodes into the subclavian vein Moreover, Park and Tarver reported cases of ... mastectomy followed by CEF (cyclophosphamide, epirubin and fluorouracil) chemotherapy and radiotherapy The clinical and histological characteristics of the primary breast cancer revealed a Stage ... years) and a pre-menopausal status are other factors that predict a longer survival of patients In the case of our patient, the recurrence after years following mastectomy, chemotherapy and radiotherapy...
- 8
- 539
- 0
Báo cáo y học: "An inflamed necrotic appendix epiploicum with immediate contact to a non-inflamed appendix vermiformis: a case report " doc
... the operations, made substantial contributions to interpretation and helped in preparing the manuscript FGB was involved in drafting the manuscript and has made substantial contributions to interpretation ... pain Three days before presenting in our department, the pain had started in the mid-epigastrium and had gradually shifted to the right lower quadrant There were no other signs of abdominal pathology, ... Patients are middle aged (40 to 45 years) and present with sharp localized pain mostly in the right or left lower abdominal quadrant [2] Additional signs of abdominal pathology such as nausea, vomiting...
- 3
- 308
- 0
Báo cáo y học: " Caseous calcification of the mitral annulus with mitral regurgitation and impairment of functional capacity: a case report" doc
... can add more precise information regarding the internal area of the mass, and cardiac fast CT, magnetic resonance imaging or single photon emission CT could also be useful However, in some cases ... GM, CM, GP and PGP made substantial contributions in the acquisition of clinical and echocardiographic data, GM, HP and MS were involved in drafting the manuscript and revising it critically, FM ... mass was lanced with a longitudinal section along the mitral annulus for all its length, and the caseous white material that filled the centre of the mass was drained Posterior ring annuloplasty...
- 4
- 344
- 0
báo cáo khoa học: " Co-expression and promoter content analyses assign a role in biotic and abiotic stress responses to plant natriuretic peptides" pptx
... irradiation This documents that AtPNP -A expression remains very high and sustained after the stress has been removed and thus may indicate that the initial damage inflicted, and not the actual ... Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression pattern of around 7,000 Arabidopsis ... both culminate in cell death indicating that AtPNP -A may be involved in these processes The mutant analyses further enforce that the transcriptional regulation of AtPNP -A and the correlated genes...
- 12
- 396
- 0
Báo cáo y học: "Readmission to a surgical intensive care unit: incidence, outcome and risk factor" ppt
... Anesthesiology and Intensive Care Medicine A consultant intensivist with a special qualification in intensive care medicine is available inhouse 24 hours a day Attending physicians and in- training residents ... of in- hospital death on a univariate basis at a p < 0.2 Continuous data are presented as mean ± standard deviation (sd) and categorical data as number and percentage, unless otherwise indicated ... neurological deficit and intracranial mass effect; gastrointestinal = bleeding (gastrointestinal tract), acute abdomen, severe pancreatitis, liver failure; respiratory = acute lung injury and acute...
- 12
- 266
- 0
Báo cáo y học: "A pilot study on peritraumatic dissociation and coping styles as risk factors for posttraumatic stress, anxiety and depression in parents after their child''''s unexpected admission to a Pediatric Intensive Care Unit" ppt
... professionals to identify parents at risk and intervene in an early stage to minimize chronic and pathologic mental health problems A next step is to replicate these findings in a larger sample of parents ... responsibility for the psychological screening of the families, data collection, data entry, all analyses and writing the manuscript AK had a major contribution on data collection, data entry, and analyses ... several earlier studies after cancer, and in general stress literature [11-13,26] Interestingly, avoidance coping strategy was not related to anxiety and depression, indicating that avoidance coping...
- 9
- 315
- 0
Series in Electrical and Computer Engineering - Vol 2 - A Mathematical Introduction to Control Theory - S. Engelberg
... exponentially damped (as they generally are in the cases of interest to us), then the total variation is finite and the theorem applies 10 A Mathematical Introduction to Control Theory It is not too ... love and appreciate learning May his memory be a blessing Preface Control theory is largely an application of the theory of complex variables, modern algebra, and linear algebra to engineering The ... of the integral of a a function is less than or equal to the integral of the absolute value of the function Using the triangle inequality and the 11 Mathematical Preliminaries generalized triangle...
- 370
- 278
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008