upon arrangement of the loan for the amount received less any transaction costs generally with a debit to accounts in subgroup 57
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with the Thermal ... denaturing gel, transferred to a PVDF sheet, and reacted with the antibody to UL7 (first panel) The same membrane was reacted with the antibosy to the flag again (second panel), to the βactin...
- 13
- 463
- 0
báo cáo hóa học:" Existence of positive solutions for fourth-order semipositone multi-point boundary value problems with a sign-changing nonlinear term" docx
... Acknowledgments The author is very grateful to Editor of the Journal and the anonymous referees for their carefully reading of the first draft of the manuscript and making many valuable suggestions 22 and ... main results The proof of the main results will be stated in Section A class of examples are given to show that our main result is applicable to many problems in Section Preliminaries and lemmas ... index theory in cone and constructing some available integral operators together with approximating technique They guarantee the existence of at least one positive solution for nonlinear fourth-order...
- 25
- 221
- 0
Báo cáo sinh học: "Probability statements about the transmitting ability of progeny-tested sires for an all-or-none trait with an application to twinning in cattle" pptx
... D )a; , Notice that k can be interpreted as in selection index theory as the ratio of a within sire to a sire variance, since p(l - p)/(p2(.) is the asymptotic variance of the normit transformation ... m r taken as fixed in uu units, variations in the progeny number n are rather less b pronounced These variations (An) in n are proportional to variations (A ) in ETA within the range of values ... ( and A is calculated for methods II and III according to formula (20) As a matter of fact, methods I, II III can be compared only when using the same amount of information, v.i.z the same n and...
- 18
- 313
- 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx
... its ability to stabilize the active form of RhoA prior to invasion YpkA and OTUB1 modulate the stability of RhoA in opposing ways, therefore leading to cytoskeletal rearrangements that may be involved ... OTUB1, as a 37 kDa polypeptide, was also found in a complex with the inactive kinase mutant YpkA D26 7A (Fig 3A) Third, invasion with the Yersinia mutant strain expressing an inactive YpkA kinase ... susceptibility to invasion is modulated by the YpkA GTPase-binding domain YpkA consists of several domains including a serine ⁄ threonine kinase and a GTPase-binding domain, both of which contribute to virulence...
- 16
- 654
- 0
Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modified protein and yields fragments with low immunoreactivity pptx
... simplicity of the approaches described above, heat denaturation and aggregation of BLG upon heat treatment may hide putative sites of attack from the action of proteases, therefore leaving intact some ... 6.8) to a final mass ratio enzyme/BLG of : 20 or of : 10 The protein/protease mixture was then placed in a thermostatted water bath for the required amount of time At the end of the heat treatment ... then placed in a water bath thermostatted at 60 °C for the given amount of time At the end of the heat treatment the mixtures were placed on ice, and the enzymatic activity was stopped by adding...
- 11
- 526
- 0
Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot
... CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAAAAGAAAAATG AGGGAACAAAAGCTGGAG GGGAGTCAGCTGTTCGGTAACAGCATCTTGCATAGGCACATCTAAATCTGTATCCTGTAGGGCGAATTGGG GCAAAGTAAAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGATATGATGAGGGAACAAAGGCTGGAG ... GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT CGGATCCCCGGGTTAATTAA CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT GAATTCGAGCTCGTTTAAAC pFA 6a- HIS3MX6 pFA 6a- HIS3MX6 pFA 6a- 13Myc-HIS3MX6 ... GTAACTTCAGGTAGTAACTGGGCCTTGTATAGCCTTTCTAAACATTCGTCCAACTGTAGGGCGAATTGGG GAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACAATGGTAAGGGAACAAAAGCTGGAG GCGCCTGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCTCTAGACTGTAGGGCGAATTGGG GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT...
- 13
- 389
- 0
Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx
... Lys77 and Asp43 may have roles in NADPH binding as well as catalysis The hypothetical catalytic mechanisms of PGDS and PGFS activities of AKR1B1 are shown schematically in Fig In the absence of NADPH, ... (5¢-GACTGCGCCCAGGTGTTCCAGAATGAGAAG-3¢) and (R) (5¢-CTTCTCATTCTGGAACACCTGGGCGCAG TC-3¢); AKR1B3 H110F (F) (5¢-GATCTCTACCTTATT TTCTGGCCAACGGGG-3¢) and (R) (5¢-CCCCGTTGGC CAGAAAATAAGGTAGAGATC-3¢) (the ... (5¢-GGGTACCGCCACA TCGAATGTGCCCATGTG-3¢) and (R) (5¢-CACATGGG CACATTCGATGTGGCGGTACCC-3¢); AKR1B1 Y48F (F) (5¢-CTGTGCCCATGTGTTCCAGAATGAGAATG-3¢) and (R) (5¢-CATTCTCATTCTGGAACACATGGGCACAG-3¢); AKR1B1...
- 11
- 390
- 0
REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds (Text with EEA relevance) docx
... rules for the handling of conflicts of interest by the EuSEF manager These rules also require the manager to have the necessary organisational and administrative arrangements in place to ensure a ... the investors in that other EuSEF EuSEF managers shall maintain and operate effective organisational and administrative arrangements in order to comply with the requirements laid down in paragraph ... European Parliament and the Council23 or in accordance with national law in relation to the EuSEF, the information referred to in paragraph of this Article may be provided either separately or as a...
- 31
- 412
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... Phosphatase-treated nuclear extracts were assayed for their DNA-binding capacity in standard EMSA UV crosslinking of DNA–protein adduct The EMSA reaction was carried out using ng labelled Jun)25 and ... acrylamide) and analysed by autoradiography changes of · binding buffer over a period of 30 and autoradiographed Affinity purification of the factor(s) interacting with the )148 to )124 region of ... in an active conformation RLjunRP is an 40 kDa protein that forms an 80-kDa protein–DNA adduct To assess approximate molecular mass of the factors interacting with the )148 to )124 region of...
- 9
- 449
- 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... under accession AJ437692 Further analyses were performed with the online tools of the European Bioinformatics Institute (http:// www.ebi.ac.uk/), BLAST database searches in the GenBank database of ... significant matches to several ESTs in the databases The novel gene was termed nicolin (NICN1) A BLAST search against the ESTdatabase with the NICN1 cDNA resulted in 85 exclusively mammalian hits with ... GFPstaining of the fusion proteins was detected in the nuclei, whereas staining of the cytosol and the nucleoli of transfected cells was less intensive These data provide strong evidence for a nuclear...
- 6
- 450
- 0
Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx
... suggests that the bHLH domain plays an important role in assisting and stabilizing heme binding to the PAS -A domain in the isolated bHLH-PAS -A domain of NPAS2 The QCM data indicated that the isolated ... understand the heme-binding character of the bHLH-PAS -A domain, we examined the association rate constants (kon) for binding of the Fe(II)–CO heme complex to the apo-bHLH-PAS -A and apo-PAS -A domains of ... domain and appears to assist in stable heme Characterization of bHLH-PAS -A of NPAS2 binding, stabilizing the protein molecule We also demonstrated specific binding of the bHLH-PAS -A protein to the...
- 12
- 360
- 0
ANNUAL REPORT OF THE GREAT LAKES REGIONAL WATER USE DATABASE REPOSITORY REPRESENTING 2006 WATER USE DATA IN GALLONS docx
... generation), in addition to new features such as a flexible data interface and automatic data checking A Great Lakes Regional Water Use Database to provide comparable water use information on withdrawals, ... the Great Lakes Basin, the database catalogs withdrawals by water use category, sub-basin and jurisdiction The database became operational in the summer of 1988 following a multi-year cooperative ... collect and record data on the volume of water taken daily and report the data on an annual basis Please contact Jonathan Staples at Jonathan.Staples@ontario.ca, Ontario Ministry of Natural Resources...
- 111
- 290
- 0
![Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt](https://media.store123doc.com/images/document/14/rc/tl/small_tlm1396203606.jpg)
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt
... (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23] cleaved with the same enzymes creating the ... thaliana IscA1) AC007067.4, P_purp (Porphyra purpurea) NP_053827, Athal2 (Arabidopsis thaliana IscA2) AC005825.3, Athal3 (Arabidopsis thaliana IscA3), AC006921.5, A_ vinIscA (Azotobacter vinelandii ... able to bind a FeS cluster The absorption spectrum was very similar to that of the variant C4 4A (data not shown) Together with the results obtained with the variants containing single mutations...
- 10
- 447
- 0
báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf
... trained clinical officers Figure Entrants4into Stage training Entrants into Stage training The proposed training system is based on the notion that all practitioners within eye care be trained ... showing the stocks and flows of personnel through training and into and out of the The computable model of an eye care MEES showing the stocks and flows of personnel through training and into and ... will be: available free of charge to the entire biomedical community At a later date, the financial data associated with the personnel flows will be addressed by adding the costs associated with...
- 6
- 442
- 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot
... and to assess the efficacy of psychosocial and psychopharmacological interventions in these patients Many health questionnaire-based instruments allowing clinicians to approach GAD at any healthcare ... those attending the practices of two of the participating clinical investigators Eight patients regularly attending the practices with a prior diagnosis of clinical GAD were randomly selected A sample ... of GAD-free subjects, sex- and age-matched to patients with GAD, was also selected To obtain the validation and scaling sample, each investigator had to recruit from 12 to 24 patients, half of...
- 11
- 537
- 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
... correlations The variance explained (the percent of the total measured variance in the SF-8 items explained by the two principal components) was also analysed The results of the principal component ... data analysis and review BR, JB involved in drafting and reviewing the manuscript KFO, TO, ES involved in reviewing the manuscript Acknowledgements Assistance with data for the sample frame was ... sample size calculation was determined based upon the requirements of the broader study noted above The sampling frame was a list of the total population of IDPs living in all the 65 officially recognised...
- 10
- 647
- 0
Response of the Affected Agency Comments on Agency Response We transmitted a draft of this report potx
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ...
- 5
- 157
- 0
Báo cáo lâm nghiệp: " Changes of the mixed mountain virgin forest after 70 years on a permanent plot in the Ukrainian Carpathians" pps
... transformed according to van der Maarel (2005) To estimate the influence of environmental factors, the eigenvalues of the corresponding ordination axes from unconstrained (PCA) and constrained ... because total timber volume was rather low and natural regeneration was abundant Nowadays the stage of growth (if we summarize its phases) and stage of disintegration cover the largest area (see ... which the main part of the area is predominated by the regenerated 2nd generation of beech That seemingly gives an impression that beech has expanded in the studied area and that fir and spruce have...
- 11
- 303
- 0
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx
... incidence in Wales with a ratio of 1:4 [1] Table 1: Anatomical location of lymphomatous lymph nodes (n = 62) Anatomical location Number of cases Cervical Inguinal Axillary Intra-abdominal Supraclavicular ... lymphomas, one of the important roles of FNAC is the exclusion of metastatic squamous carcinoma as this requires an alternative therapeutic approach There is a question as to the accuracy of FNAC in ... endoscopy and laparoscopy in obtaining biopsy material The advent of endoscopic ultrasound-guided FNAC allows targeting of mediastinal and intra-abdominal lymphadenopathy, which can be performed without...
- 4
- 435
- 0
Báo cáo y học: "Portal hypertensive enteropathy diagnosed by capsule endoscopy and demonstration of the ileal changes after transjugular intrahepatic portosystemic shunt placement: a case report" docx
... performed the ultrasound examination of the patient before and after TIPS placement VC performed several upper GI endoscopies in the patient AC helped in analysis and interpretation of the data SG made ... nextof-kin for publication of this manuscript and accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Pezzoli et al Journal of Medical Case ... technique to reduce portal hypertension and to control variceal bleeding [13], but no data are available about its effect on jejunal mucosa in cases of PHE The American Association for the Study of...
- 4
- 314
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25