to create individually controlled soluble microenvironments in a multi channel 3d μfccs for functional enhancement of multiple cell types
Engineering soluble microenvironments in microfluidic systems
... controlled- release carriers.124-126 It is reported that carriers made of gelatin could enhance the bioavailability of calcitonin after nasal and intramuscular administration to rats.127 Gelatin has already been ... consisting of an insoluble extracellular matrix (ECM) which contains proteins for cell adhesion and cell- matrix interactions, neighboring cells that allow for extensive cell- cell interactions, and soluble ... natural materials such as hyaluronic acid (HA), collagen, fibrin, alginate and chitin.52 They are biocompatible and not toxicic to cells Natural hydrogels and scaffolds intrinsically contain a...
- 149
- 513
- 0
Overcoming mass transfer barriers in sandwich configuration for primary hepatocytes culture
... normal accumulation of actin at the cell margins and inhibit canaliculi formation Microfilament-perturbing agents (cytochalasin D, phalloidin) have little effect on the initiation of canalicular ... reported that hepatocytes remained as a monolayer but underwent major changes at the intracellular level that culminated in the formation of a 2-dimensional, multicellular network with a functional bile ... was carried out in SAMCO Basic Plasma Kit (SAMCO INTERNATIONAL INC.) operating at a radio frequency of 13.6MHz Argon was introduced into the chamber in the SAMCO kit at a flow rate of 50ml/min...
- 105
- 214
- 0
A STUDY ON techniques to teach english vocabulary for primary schools in quang ninh
... general, vocabulary is a component of language that maintains all of information about meaning and using word in language (Harimurti kridalaksana 1993-27).It is one of the important factors in learning ... Therefore, a person's vocabulary is the set of words they are familiar with in a language Types of vocabulary In general, vocabulary is divided into four types: reading vocabulary, listening vocabulary, ... vocabulary, writing vocabulary and speaking vocabulary 2.1 Reading vocabulary Reading vocabulary is made up of the words in print that we recognize or can figure out A person's reading vocabulary...
- 78
- 1,607
- 8
The National Curriculum Handbook for primary teachers in England doc
... DfEE and QCA, show how the programmes of study and the attainment targets can be translated into practical, manageable teaching plans Attainment targets and level descriptions An attainment target ... opinions and actions Drama To participate in a range of drama activities, pupils should be taught to: a use language and actions to explore and convey situations, characters and emotions b create ... of language in literary and non-literary texts and learn how language works Speaking and listening: during key stage pupils learn how to speak in a range of contexts, adapting what they say and...
- 192
- 492
- 0
Tài liệu Evidence-Based Guidelines for Migraine Headache in the Primary Care Setting: Pharmacological Management of Acute Attacks doc
... headache, and cluster headache) In secondary headaches, the headache is a symptom of a secondary abnormality such as dental pain, subarachnoid hemorrhage, or brain tumor As part of diagnosing ... Headache 1978;18(1):35-39 31 Hakkarainen H, Quiding H, Stockman O Mild analgesics as an alternative to ergotamine in migraine A comparative trial with acetylsalicylic acid, ergotamine tartrate, ... a definitive algorithmic approach to the pharmacological therapy of acute migraine attacks Further, the lack of head -to- head clinical trials comparing the relative efficacy and cost/benefit among...
- 58
- 534
- 0
Effective techniques to teach English for 1st graders at Vo Thi Sau primary school in Hai Phong city.
... identical in form to a statement, except for the final rising tone Ex: You realize what risks are? Exclamatory question: a question in form but is functionally like an exclamatory They are marked ... linguistic meanings which are communicated by particular units of language and utterance meanings which occur as truncations between individuals in a particular place, at a particular time Basically, ... waited for your local agents to fix the machine The scanner has broken again Although service is included on a one- year warranty, we not want it serviced again Instead, we want you to replace...
- 75
- 499
- 0
Attitudes, barriers and facilitators for health promotion in the elderly in primary care doc
... years Twenty eight of the GPs were working in an urban or suburban area, nine in a rural area All GPs were working in a primary care practice; some of them had an additional education in geriatrics ... Demographic data The age of the participating GPs ranged from 40 to 69 years, with a mean age of 56.1 years as shown in table Working experience of the GPs varied from one to 35 years with a mean of 18.6 ... and enablers of health promotion, prevention and early intervention in primary care: Evidence to inform the Australian national dementia strategy Australasian J Ageing 2009;28(2):51–7 Zyska Cherix...
- 5
- 694
- 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
... [8] indicate that its alanineglyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities In the ... Apolipoprotein A- I Abhydrolase domain containing 14b D-Amino Protein name ApoA4 ActB Nsfl1C Acy1 Pgam1 Inmt Prdx6 ApoA1 Abhd14b DnaJA1 Pdzk1 Hao3 Erp29 Aco1 Me1 Eno1 Dao1 Hao3 Mpst Acads Short name 15488745 ... decrease in cytosolic malic enzyme was observed, pointing to a reduction in NADPH available for fatty acid biosynthesis Taken together, these results seem to be indicative of an adaptation in favor...
- 9
- 481
- 0
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx
... fractions (Fig 7) Laminaripentaose, N-acetylchitooctaose and glycolchitin remained inactive Laminarin and the AaGlucan triggered a similar level of chitinase activity However, laminarin was applied ... X78269 U62734 AF484252 AF004232 AF272244 (F)TCGCCTTGTGGAAGTTTGAGAC (R)AACATTGTCACCAGGGAGTGCC (F)CAGGAGGGTATTGCTTTGTTAGGC (R)ATCTTCCACTGCGTCATTCCGTCC (F)GCCATAGGAGTGGACCTGCTAAAC (R)AAAAGACCTCTGGTTGCCGC ... accumulation in soybean Plant Cell 3, 127– 136 Saito M, Shinya T, Hanai K, Katagi T & Matsuoka H (2004) A novel chitinase isozyme in tobacco BY-2 cells induced by the autoclaved Alternaria alternata...
- 11
- 358
- 0
A study on techniques to improve English vocabulary for 3th graders at Quang Trung primary school in Hai Phong
... used as a means of international communication Therefore, there has been an explosion in the need of teaching and learning English all over the world It has been, in fact said that language was a ... describes ways of thinking about learning and teaching that emphasize student responsibility for such activities as planning learning, interacting with teachers and other students, researching, and assessing ... vocabulary really plays an important role because it appears in every language skills: listening, speaking, reading, writing Obviously, vocabulary is really important in any language learning However,...
- 114
- 1,134
- 2
Báo cáo hóa học: " Mutation or loss of Wilms’ tumor gene 1 (WT1) are not major reasons for immune escape in patients with AML receiving WT1 peptide vaccination" ppt
... analysis and interpretation of data and wrote the manuscript; AL, AN and OS have made substantial contributions to acquisition of data, analysis and interpretation of data CS have been involved in ... within a phase II vaccination trial and progressed after an initial interval of vaccine efficacy [8] T cell response to vaccination was analyzed as previously published in Keilholz et al 2009 (patient ... Page of Mutation analysis Base exchanges within the epitope sequence or epitope flanking sequences (10 amino acids N- and C-terminal of the epitope) were analyzed with melting point analysis after...
- 4
- 424
- 0
Báo cáo hóa học: " Research Article Three Novell Analog-Domain Algorithms for Motion Detection in Video Surveillance Arnaud Verdant,1 Patrick Villard,1 Antoine Dupret,2 and Herv´ Mathias3 e" pdf
... 8-bit images are converted into voltage signal on a 1.8 V dynamic range An additional Gaussian noise with a 1.1 mV standard deviation is added to each image During processing, a second Gaussian noise ... during the parallel processing In order to take into account the impact of the nonidealities introduced by the analog parts and to get an accurate evaluation of power consumption, the analog blocks ... from a SAR ADC; therefore, the scaling of the CMOS technology brings the same improvements as for the classical SAR ADC So as to take into account technological parameters in these simulations,...
- 13
- 414
- 0
Báo cáo hóa học: " Research Article Nonlinear Synchronization for Automatic Learning of 3D Pose Variability in Human Motion Sequences M. Mozerov, I" pot
... constrained, and these natural constraints lead to highly correlated data in the original space Therefore, we aim to find a more compact representation of the original data to avoid redundancy To ... describes a natural mode of variation of human motion Additionally, the main modes of variation of human gait are naturally represented by means of the principal components found This leads to a coarse -to- fine ... computed standard deviation σ t (dashed black line) for the walking action We used b = dimensions for building the PCA space representation explaining the 93% of total variation of training data On...
- 10
- 322
- 0
Báo cáo hóa học: " Research Article Adaptive Probabilistic Tracking Embedded in Smart Cameras for Distributed Surveillance in a 3D Model" doc
... localization visualization of all your buddies instead of just a binary online/away classification Additionally, an idea is that available navigation software could be used on top of this to allow ... tracking data, and takes care of person handover 3.2.1 Background modeling and autoinit In contrast to Section 2, we take advantage of the fact that each camera is mounted statically This enables ... per camera node in world coordinates This information is forwarded both to the person handover unit and to a log file that allows for debugging and playback of recorded data Additionally, raw camera...
- 17
- 436
- 0
Guide for Sound Insulation in Wood Frame Construction Part 1 pot
... Typical Vertical Flanking (Impact) 51 Changes to Control Vertical Flanking (One apartment above another, Impact sound source) 53 Table of Change in Vertical Flanking due to Toppings ... rooms by paths other than directly through the nominally separating wall or floor assembly Flanking exists in all buildings and its importance in determining the apparent sound insulation (that perceived ... concepts for transmission of flanking sound in buildings, and a general design approach, this Guide divides into two main parts focusing in more detail on transmission of sound from airborne...
- 5
- 273
- 0
Báo cáo y học: "Sigma-1 receptor agonist fluvoxamine for postoperative delirium in older adults: report of three cases" docx
... of the study and participated in its study and coordination Both authors read and approved the final manuscript Author Details 1Department of Psychiatry, Asahikawa Red Cross Hospital, Asahikawa, ... admitted to a health and mental centre for older patients for years The patient was diagnosed with abdominal aortic aneurysm, and was a candidate for surgery He underwent the operation using a custom-made ... custom-made stent graft for abdominal aortic aneurysm After his operation, he had insomnia and was in a seditious state Therefore, he was referred to the hospital's department of psychiatry He was...
- 3
- 323
- 0
Báo cáo khoa học: "Human vascular adhesion proteın-1 (VAP-1): Serum levels for hepatocellular carcinoma in non-alcoholic and alcoholic fatty liver disease" pdf
... peroxidase was added into the wells, and the plates were allowed to incubate at room temperature again for h Finally, plates were washed six times with Tween/PBS and generated after combining with ... after a 3-min incubation time Each sample was measured in triplicate with both the anti-VAP-1 mAb and the negative control mAb The specific VAP-1 value was calculated by subtracting the mean background ... Collected data and wrote the manuscript in draft ASK- Carried out the biochemical analysis SP-Carried out the statistical analysis AS, ACD,VITook part in and contributed the discussion All authors have...
- 4
- 294
- 0
Báo cáo khoa học: "SemiDecreased 3D observer variation with matched CT-MRI, for target delineation in Nasopharynx cancer" pdf
... delineated, was available on-line for the observer The atlas was generated from the TNM atlas and available to the observer in multiple planes The instructions for delineation of invaded bone was adapted ... observers what to delineate is rare Therefore we choose an arbitrary cutoff of 80% agreement, as described in an earlier analysis in lung cancer [15] The median surface for each patient was manually ... brother software enabling analysis of the data, PN: observer, design of the study, FPam: Radiologist, interpretation of anatomical location of variation, design of the delineation atlas, AE: observer,...
- 8
- 234
- 0
Báo cáo khoa học: "High-dose rate brachytherapy (HDRB) for primary or recurrent cancer in the vagina" docx
... shielded vaginal applicators to protect the uninvolved vaginal mucosa Orthogonal X-ray films were obtained for planning and verification of applicator placement The median dose for intracavitary brachytherapy ... vaginal ulcer with significant narrowing and shortening of vagina (length of residual vagina was about cm) Both these patients had proximal vaginal disease and had prior radiation therapy and ... target volume defined based on clinical and imaging findings at the time of implantation(Figure 1) Pretreatment clinical findings and imaging were also taken for reference for defining the target...
- 5
- 552
- 0
Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf
... significant improvement in clinical indicators of pain and disease activity A first randomized controlled trial in patients with knee OA demonstrated a good safety profile for one intra-articular injection ... of a single intra-articular injection of anakinra (50 or 150 mg) in 170 patients with symptomatic OA of the knee [9] There was no improvement in knee pain, function, or measures of cartilage ... only involved in the structural damage process of OA but also plays an important role in pain transmission Results from in vitro studies and animal models of OA support the dominant role of IL-1β...
- 2
- 412
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25