0

the risk to a financial institution s condition resulting from adverse movements in foreign exchange rates

International Accounting Standard 21 The Effects of Changes in Foreign Exchange Rates potx

International Accounting Standard 21 The Effects of Changes in Foreign Exchange Rates potx

Kế toán - Kiểm toán

... This Standard also permits a stand-alone entity preparing financial statements or an entity preparing separate financial statements in accordance with IAS 27 Consolidated and Separate Financial ... referred to in paragraph 39(c) result from: (a) translating income and expenses at the exchange rates at the dates of the transactions and assets and liabilities at the closing rate Such exchange ... economy ceases to be hyperinflationary and the entity no longer restates its financial statements in accordance with IAS 29, it shall use as the historical costs for translation into the presentation...
  • 10
  • 523
  • 1
IAS 21  The Effects of Changes in Foreign Exchange Rates

IAS 21 The Effects of Changes in Foreign Exchange Rates

Tiêu chuẩn - Qui chuẩn

... a partial disposal of an interest in an associate that includes a foreign operation is a financial asset that includes a foreign operation 48B On disposal of a subsidiary that includes a foreign ... transactions and assets and liabilities at the closing rate (b) translating the opening net assets at a closing rate that differs from the previous closing rate These exchange differences are ... presenting profit or loss and other comprehensive income are translated at exchange rates at the dates of the transactions (ie last year s comparatives are translated at last year s actual or average...
  • 22
  • 411
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps

Báo cáo khoa học

... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal ... increase chances of cure the patients accepting possible risks in a matter of decades in case of success IMRT was feasible even if anaesthesia was necessary and resulted in good local control rates for ... administered using a simultaneous integrated boost concept During treatment all patients were evaluated at least on a weekly basis to assess acute toxicity A Siemens linear accelerator (Medical...
  • 10
  • 523
  • 0
The Key to a Winning Sales Message

The Key to a Winning Sales Message

Tiếp thị - Bán hàng

... Inc.com, the world 's most visited sales-oriented blog His newly published book is Business to Business Selling: Power Words and Strategies From the World 's Top Sales Experts @Sales_Source ... print services company thus can pass the economies of scale along to you." The rewritten message will need to be buttressed with some stories about existing customers and a credible source for the ... actually spark an emotional response (i.e showing) Now rewrite the message so that it shows rather than tells Here 's a real life example: By editing out the biz-blab and showing rather than telling,...
  • 3
  • 445
  • 0
Tài liệu The Early Bird A Business Man''''s Love Story pdf

Tài liệu The Early Bird A Business Man''''s Love Story pdf

Quản trị kinh doanh

... Miss Westlake and Miss Hastings as they separated Miss Hastings did her best on the way back to console Mr Turner for the absence of Miss Westlake Vivacious as she always was, she never was more ... the porch." The new guest was reaching for pencil and paper as they gathered their chairs together The two girls had already started hesitantly to efface themselves Half-way across the lawn they ... with a mild gray eye and an appearance of well-fed and kindly laziness; a man also who had the record of having ruthlessly smashed more business competitors than any two other pirates in his line...
  • 91
  • 411
  • 0
Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx

Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx

Kỹ thuật lập trình

... a customer in the memory you have to declare an array of characters or use an object of the C++ string class In order to use the string class you need to add #include as a preprocessor ... for an int You can substitute the data type used inside the parenthesis Before manipulating a variable, you must assign a value to it You can assign a value at the time you declare a variable – ... studying compound data types and user defined data types later Declaring data types enables the compiler to set aside necessary amount of memory storage For example, short integer takes bytes...
  • 6
  • 400
  • 0
Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt

Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt

Kỹ thuật lập trình

... remainder; Variables that are used in the main are declared There are six variables of type integer These variable names (identifiers) stand for memory locations In each of these memory locations, ... program must have a main function A program begins executing with the main function Main returns an integer value to DOS { The left bracket indicates the beginning of the main int dollar, quarterR, ... problem What are the known information about this programming assignemnt? There are ten dollars in a quarter roll There are five dollars in a dime roll There are two dollars in a nickel roll And there...
  • 13
  • 358
  • 0
how to practice  the way to a meaningful life dalai lama

how to practice the way to a meaningful life dalai lama

Tâm lý - Nghệ thuật sống

... already know one another, profoundly, as human beings who share the same basic goals: We all seek happiness and not want suffering TWO WAYS TO HAPPINESS There are two ways to create happiness ... served as his chief translatoron lecture tours in the United States, Canada, Indonesia, Singapore, Malaysia, Australia, Great Britain, and Switzerland, I have witnessed his embodiment of these ... Holiness the Dalai Lama teach in 1972 Just three days after my arrival in Dharamsala in northern India he started a sixteen-day lecture series for four to six hours each day on the stages of the...
  • 103
  • 557
  • 1
introduction – imf as a financial institution

introduction – imf as a financial institution

Phân tích tài chính doanh nghiệp

... countries' vulnerabilities to crises; - The Financial Sector Assessment Program (FSAP) In collaboration with the World Bank, the FSAP assesses countries’ financial sectors and helps - formulate policy ... way for investment activities and financial aid from financial institution as well as other countries It also plays a mediating role of solving the crisis, standing out for settling solutions ... then spread to Korea, Japan, and Hong Kong, Russia and even causes a serious crisis on financial market of this country The European and American investors have diverted the investments from Asia...
  • 14
  • 1,990
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Long term outcome of adolescent and adult patients with pineal parenchymal tumors treated with fractionated radiotherapy between 1982 and 2003 - a single institution’s experience" pot

Báo cáo khoa học

... crucial in suspected pineocytomas, to decrease the likelihood of a histological misdiagnosis as a possible cause for this aggressive behavior Kurisaka et al [16] were able to show, that additional ... histological features with prognosis in 66 cases Brain Pathol 2000, 10(1):49-60, Review Anan M, Ishii K, Nakamura T, Yamashita M, Katayama S, Sainoo M, Nagatomi H, Kobayashi H: Postoperative adjuvant ... Gy) The craniospinal axis was also treated in both patients with pineoblastoma recurrences In all pineoblastoma patients a boost to the pineal tumor with a median TD of 54.2 Gy (50-60 Gy) was administered...
  • 7
  • 365
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps

Báo cáo khoa học

... J.L., San Cristobal M., Gianola D., Im S. , Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal ... and more as selection intensity is increased, while the parentoffspring regression remains constant in the simulations as in the approximate theory (not shown) DISCUSSION 5.1 Model for the variance ... needed in this area, keeping in mind that the approach used, according to which most distributions are approximated by the (one generation), such Gaussian ones that share the same first and second...
  • 29
  • 347
  • 0
Báo cáo y học:

Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx

Báo cáo khoa học

... dilatory response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI is taken ... were caused by an inability of DIs to dilate constricted airways, as opposed to an increased responsiveness of the airway itself [5] Remarkably, Salter had come to the much the same conclusion ... reports The potent dilating response to a DI observed in normal individuals fails in asthmatics Bridge dynamics and plastic reorganization of the cytoskeleton are surely important factors, but...
  • 3
  • 252
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps

Báo cáo khoa học

... That is, the bracket that showed the highest LRT in the single-QTL analysis was included as a random effect in the QTL model in turn, and the analysis was repeated These analyses searched for an ... performed SNP genotyping in two stages First, 75 animals i.e the gransires of the nine initial GD families and their ancestors, and also a number of potential GDfamily sires and their ancestors, were ... DD 2A AAGAGGAAAGCCCGGAAGAAGGGAG G A •••••••••••GG•••••AC• G••G•••••••AAAA••AC••AAC• G A ••••••••• A A G••AC• GGA• A G•• A AAG A •••AC• G•• A G•• A •••G A •••AC• G 36 Figure Familial relationships...
  • 11
  • 357
  • 0
Báo cáo y học:

Báo cáo y học: "Phagosome proteomes open the way to a better understanding of phagosome function" ppsx

Báo cáo khoa học

... stages in phagocytosis and phagosome maturation A microbe initially binds via molecules on its surface to receptors on the plasma membrane of the phagocyte This activates the receptors, causing ... detailed kinetic analysis In contrast to phagocytosis in mammalian cells, in which the particles, or their remains, usually stay within the cells, Dictyostelium phagosomes synchronously exocytose ... suggested in the earlier proteomic analyses, such as components of the spliceosome and of protein translation machinery, whose role in phagosomes remains to be demonstrated Less surprising was the...
  • 4
  • 239
  • 0
grid computing esis analysis of its impact on business and the shift to a services infrastructure

grid computing esis analysis of its impact on business and the shift to a services infrastructure

Điện - Điện tử

... TREMENDOUS COST SAVINGS ACROSS A BANK CLUSTERS AND GRIDS EMPLOYED TO ESTIMATE A BANK S RISK EXPOSURE EVERY DAY LOWERING RISK RESERVES CAN SAVE BILLIONS • BANKS INITIALLY USED CLUSTERS & GRIDS TO RUN RISK ... SOPHISTICATED MATHEMATICAL MODELS TO DO SOPHISTICATED RISK ANALYSIS ACROSS ALL PARTS OF BANKS THIS WOULD NOT BE POSSIBLE WITHOUT VERY LARGE CLUSTERS & PARALLEL PROCESSING • REDUCING THESE COSTS ... computing; – It addresses the issues of security, policy, payment, membership, and so forth that arise in these settings Otherwise, we are dealing with a local management system a Uses standard,...
  • 41
  • 212
  • 0
THE STORY OF A MOTHER -Andersen’s Fairy Tales

THE STORY OF A MOTHER -Andersen’s Fairy Tales

Tư liệu khác

... flowers and trees grew strangely into one another There stood fine hyacinths under glass bells, and there stood strong-stemmed peonies; there grew water plants, some so fresh, others half sick, the ... more, and her eyes sunk down in the depths of the waters, and became two precious pearls; but the water bore her up, as if she sat in a swing, and she flew in the rocking waves to the shore on the ... sick, the water-snakes lay down on them, and black crabs pinched their stalks There stood beautiful palm-trees, oaks, and plantains; there stood parsley and flowering thyme: every tree and every...
  • 8
  • 400
  • 0
AN0858   interfacing the MCP215X to a host controller

AN0858 interfacing the MCP215X to a host controller

Cao đẳng - Đại học

... Serial Send Routine ; This routine uses the uart to send a single data byte to ; the MCP215x with hardware handshake ; Data is passed in register called "hostdata" ; ; Wait for UART to be ready ... Interface is not available The CTS signal indicates when the Host Controller can send serial data and when the Host Controller should not send serial data, since asynchronous IR Data is being sent ... Response to these XIDs Broadcast ID No Response to Broadcast ID Discovery Send SNRM Command (w/ parameters and connection address) UA response with parameters using connect address Open channel...
  • 38
  • 247
  • 0
Báo cáo Y học: Expanding the scorpion toxin a-KTX 15 family with AmmTX3 from Androctonus mauretanicus pptx

Báo cáo Y học: Expanding the scorpion toxin a-KTX 15 family with AmmTX3 from Androctonus mauretanicus pptx

Báo cáo khoa học

... (Micromass), as previously described [9,15] MALDI-TOF/MS was performed on a Perseptive DE-RP (Applied Biosystem) using a- cyano-4-hydroxycinnamic acid as matrix designed to suppress Na+ and Ca2+ ... toxins The toxins sBmTX3 and native AmmTX3 were radioiodinated by the lactoperoxidase method, as previously described [8] MALDI-TOF/MS was used to check that the derivatives were monoiodinated ... molecular mass, determined by ES/MS of the native peptide, was 3823.5 Da (Fig 1B, inset) This was 16 Da less than the mass deduced from amino acid composition (3839.5 Da) This difference is consistent...
  • 5
  • 462
  • 0
báo cáo sinh học:

báo cáo sinh học:" Assessing the impact of a new health sector pay system upon NHS staff in England" pot

Điện - Điện tử

... turnover, absence rates) ; secondly to assess the national situation through analysis of national level data and information on costs and impact; and thirdly to assess the relevance and effectiveness ... informants who had been involved in the national negotiations Table 3: Case study NHS hospital trusts, March-May 2007 Case study Case study 2: Case study Case study Case study Case study Case study ... lessons can be learned and any necessary changes made Given the scale of the exercise, its costs and assumed benefits, the absence of any full and systematic evaluation constrains the overall...
  • 7
  • 453
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008