0

the man has got a long face and a pointed nose he has got a small moustache and short black hair his eyes are small and he has a scar on his left cheek

Báo cáo khoa học:

Báo cáo khoa học: "The impact of compliance with 6-hour and 24-hour sepsis bundles on hospital mortality in patients with severe sepsis: a prospective observational study" pdf

Báo cáo khoa học

... were admitted into critical care and 59% (42/71) of these patients achieved all goals in the 6hour sepsis bundle The acute physiology and chronic health evaluation (APACHE) II score and the predicted ... individually For instance, the highest potential survival rate from cardiac arrest can only be achieved when the cardiac chain of survival, 'the care bundle' in cardiac arrest, occurs as rapidly as ... process measures rather than the more resource-intensive outcome measures may be the better way for the NHS healthcare system to monitor performance and for the NHS hospitals to compare performance...
  • 7
  • 394
  • 0
Tài liệu The Compleat Strategyst - Being a Primer on the Theory of Games of Strategy pdf

Tài liệu The Compleat Strategyst - Being a Primer on the Theory of Games of Strategy pdf

Cao đẳng - Đại học

... Periodically, RAND Corporation researchers publish with commercial presses These books are not available from RAND but can be requested directly from the publisher, except in cases where the rights ... requested directly from the publisher, except in cases where the rights have reverted to RAND and we have republished a new edition ...
  • 286
  • 512
  • 0
The Situation of Elderly People in Turkey and National Plan of Action on Ageing potx

The Situation of Elderly People in Turkey and National Plan of Action on Ageing potx

Sức khỏe người cao tuổi

... Turkey and National Plan of Action on Ageing child death rates also decreased rapidly, as a result of the increase in the antenatal and postnatal care and vaccination rates Infant death rate which ... focuses on four main areas These areas are advocacy, technical assistance, education and research As part of its efforts in the implementation of the Madrid International Plan of Action on Ageing, ... outside the family where the individual has a reputable place and authority, is not an easily acceptable situation Losing his/ her status within the society and abandoning the environment he/ she is...
  • 142
  • 845
  • 0
Báo cáo toán học:

Báo cáo toán học: " The Translational Hull of a Strongly Right or Left Adequate Semigroup" pdf

Báo cáo khoa học

... that the translational hull of a type -A semigroup is still of the same type [6], it is natural to ask whether the translational hull of C-Ehresmann semigroups and their generalized classes are ... investigated the translational hull of a type -A semigroup, in particular, the result obtained by Ault [1] was substantially generalized and extended Thus, the translational hull of a semigroup plays ... strongly rpp semigroup Again by Lemma 3.7 and the definition of a strongly right (left) adequate semigroup, we can formulate our main theorem Theorem 3.8 (i) The translational hull of a strongly...
  • 7
  • 347
  • 0
báo cáo khoa học:

báo cáo khoa học: " Reconsidering the public health failings of the criminal justice system: a reflection on the case of Scott Ortiz" potx

Báo cáo khoa học

... judiciary being the main target for action Correction is a public safety rather than a public health activity, and therefore the justice system and prison life itself are not organized in accordance ... in the realm of drug policy and illustrates the extent to which dominant social narratives that portray drug users as reckless and lacking regard for the health of others have penetrated the ... judiciary This is particularly disturbing given the power and independence afforded to the judicial system Further, the case of Mr Ortiz also demonstrates how the blurring of criminal justice and health...
  • 2
  • 256
  • 0
Báo cáo y học:

Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx

Báo cáo khoa học

... CGGGCAAGAAGCTGCTTCT CCACACCGCAGGGACAAACCCT CCACACCGCAGGGACAAACCCT SP-D ACACAGGCTGGTGGACAGTTG CCTCTCCACGCTCTGCCGCGT TGTTGCAAGGCGGCATT 36B4 CCACGCTGCTGAACATGCT AACATCTCCCCCTTCTCCTTTGGGCTT TCGAACACCTGCTGGATGAC ... indicated by the abundance of the ~22 kDa intermediate The effects on proSP-C and mature SP-C by IL-13 and IFN-g were similar in rat and human ATII cells, whereas the effects on other surfactant ... deidentified organ donors whose lungs were not suitable for transplantation and donated for medical research through the National Disease Research Interchange (Philadelphia, PA) and the International Institute...
  • 13
  • 256
  • 0
1593272944 {8C789BFD} the book of ruby  a hands on guide for the adventurous collingbourne 2011 07 16

1593272944 {8C789BFD} the book of ruby a hands on guide for the adventurous collingbourne 2011 07 16

Kỹ thuật lập trình

... the ancestor class Passing Arguments to the Superclass Parentheses matter when calling the superclass! If the argument list is empty and no parentheses are used, all arguments are passed to the ... instance variables, and you can set the values of all of them with the single initialize method rather than with many separate “set” methods; second, if the variables are all automatically initialized ... “related” classes Each class in Ruby has only one parent It may, however, descend from a long and distinguished family tree with many generations of parents, grandparents, great-grandparents, and...
  • 402
  • 864
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Báo cáo khoa học

... bulk acetylation pattern of histones, and in this way alter the structure of chromatin incorporating them To see whether the increased transcription leakage observed at early addition of TSA can ... that early TSA addition increases the acetylation status of bulk histones as well as the histones organizing the minichromosomes Structural alterations in nucleosomal organization caused by TSA treatment ... Astrand et al (Eur J Biochem 271) genes The studies have revealed that both histone acetyltransferases (HATs) and histone deacetylases (HDACs) play a vital role in gene regulation by either allowing...
  • 10
  • 500
  • 0
the man who mistook his wife for a hat and other clinical-oliver sacks

the man who mistook his wife for a hat and other clinical-oliver sacks

Kế hoạch kinh doanh

... preserved, and in others absolutely, incomprehensibly devastated How could he, on the one hand, mistake his wife for a hat and, on the other, function, as apparently he still did, as a teacher at the ... and left- hemisphere lesions, says they have lost 'abstract' and 'propositional' thought -and compares them with dogs (or, rather, he compares dogs to patients with aphasia) Dr P., on the other hand, ... solve them easily; and he was far better and sharper than anyone else at games And as he found this out, he grew fretful and restless again, and wandered the corridors, uneasy and bored and with a...
  • 127
  • 405
  • 0
Báo cáo y học:

Báo cáo y học: "Salmonella enterica ssp. arizonae infection in a 43-year-old Italian man with hypoglobulinemia: a case report and review of the literature" pptx

Báo cáo khoa học

... He continued to improve and fecal cultures taken one week and two weeks after the discontinuation of antibiotic therapy were negative Discussion Salmonella spp are Gram-negative bacilli and members ... Sheffield, UK Authors’ contributions SD and MM monitored our patient during hospitalization and analyzed data from the literature EB isolated and identified the bacterium AC, PN and ST performed the follow-up ... follow-up of our patient after discharge EJ was the major Page of contributor in writing the manuscript NP reviewed the manuscript All authors have read and approved the final manuscript Competing...
  • 4
  • 375
  • 0
báo cáo khoa học:

báo cáo khoa học:"A retrospective analysis of submissions, acceptance rate, open peer review operations, and prepublication bias of the multidisciplinary open access journal Head & Face Medicine" doc

Báo cáo khoa học

... interpreted the data, reviewed all iterations of the paper, and wrote the first draft and the final version of the paper UM interpreted the data, and reviewed and contributed to the writing of all iterations ... data, reviewed all iterations of the paper and contributed to the writing of the manuscript MC and ZCC revised the English grammar of the final version of the manuscript All authors approved the ... iterations of the paper, including the final version of the manuscript HPW and JK participated in discussions on the undertaking of the study, interpreted the data, reviewed the paper for content and...
  • 7
  • 265
  • 0
a study on theory of iceberg in  the old man and the sea  by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm  ông già và biển cả  của ernerst hemingway

a study on theory of iceberg in the old man and the sea by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm ông già và biển cả của ernerst hemingway

Khoa học xã hội

... in The Old Man and the Sea is the man, the marlin, the sharks, the sea and the effort of the man to take the marlin offshore 2.2 The hidden part and its components There are many layers of meaning ... Mexico On land, the action takes place in a small village on the northern coast of Cuba, below the Tropic of Cancer and not far from the capital city of Havana Havana is the capital of Cuba and ... Santiago hooks the marlin on his first afternoon at sea, the marlin refuses to come to the surface and pulls Santiago farther and farther from land Santiago admires the marlin‘s beauty and endurance,...
  • 49
  • 1,777
  • 7
A study on the problem face by students in reading English for business at University of Economics and Business administration-Thai Nguyen University and some i

A study on the problem face by students in reading English for business at University of Economics and Business administration-Thai Nguyen University and some i

Sư phạm

... results and the interpretation of the data Having analyzed the information, the researcher has found out the problems faced by the students in their ESP reading lessons at TUEBA and their causes ... teaching and learning ESP at TUEBA 2.4.1 Problems on the part of the teachers The English division has 10 teachers, of which, teachers are from 25 to 30 years old and the other two are at the age ... behind their ideas As the sharing takes place, new ideas may arise by the association Those ideas are added to the map as well Then, ideas are generated on both individual and group levels Once all...
  • 67
  • 1,208
  • 2
Cambridge.University.Press.The.American.Puritan.Elegy.A.Literary.and.Cultural.Study.Jun.2000.pdf

Cambridge.University.Press.The.American.Puritan.Elegy.A.Literary.and.Cultural.Study.Jun.2000.pdf

TOEFL - IELTS - TOEIC

... eBook (Adobe Reader) ISBN 0-521-66245-1 hardback For my parents Jeanne Weldon Hammond and Evan Ronald Hammond The hand of the Lord was upon me, and carried me out in the Spirit of the Lord, and ... the naive  The American Puritan elegy conviction that human nature is in all respects constant and immutable, that it always manifests itself in the same manner regardless of time and place There ... maligned poems are the simplest ones Why did Puritans write them? Why did they write so many of them? Why are the poems so much alike? Why are the commemorated dead variations onThe American...
  • 282
  • 885
  • 4
Cambridge.University.Press.War.and.the.Law.of.Nations.A.General.History.Sep.2005.pdf

Cambridge.University.Press.War.and.the.Law.of.Nations.A.General.History.Sep.2005.pdf

TOEFL - IELTS - TOEIC

... negative, then the process was repeated, and a second mission sent This time, the Aztec ambassadors anointed the right arm and head of the other ruler, set a tuft of feathers on his head and gave ... important contributions to military victory The arts of the priest, the tax-gatherer, the bureaucrat and the ruler are all required ´ The Bhagavad Gita, translated by Juan Mascaro (Harmondsworth: ... ‘Fetiales’; and Watson, International Law 28 WAR AND THE LAW OF NATIONS code of warfare’.57 One point that may be noted about the Roman practice was that the expression ‘declaration of war’ (indictio...
  • 456
  • 936
  • 7
The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

Môi trường

... compared to the total metal content The dried and ground samples gave about 96% of the average value of the three measurements, the sum of the five fractions in the sequential extraction 104% and ... Metals # -value calculated from the sludge and the recycled compost Fig Comparison of the metal speciation calculated from the metal in the mixture's components and the speciation measured in the ... compost The composting process had the same effect on the speciation of Pb Therefore the mobility and plant availability of Pb were significantly reduced, because the leachability and plant availability...
  • 14
  • 1,026
  • 0
Arms and the Man

Arms and the Man

Tài liệu khác

... three chains On the left, further forward, is an ottoman The washstand, against the wall on the left, consists of an enamelled iron basin with a pail beneath it in a painted metal frame, and a single ... carpet, and all the ornamental textile fabrics in the room are oriental and gorgeous: the paper on the walls is occidental and paltry Above the head of the bed, which stands against a little wall ... war and the theatre Shaw does not know that it is unpardonable sin to have his characters make long speeches at one another, apparently thinking that this embargo applies only to long speeches...
  • 21
  • 514
  • 0
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school

A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school

Thạc sĩ - Cao học

... Variables In the traditional teaching method, a teacher plays the role of the controller or manager of the class The teacher can teach anything they find necessary and students are only the listeners ... Students have to what their teacher tells them Teacher can ask students questions and their students have to answer Nevertheless, the traditional teaching method has many limitations and has been ... which makes them hard to listen and speak Only one interviewee says that he is good at listening and speaking and wants to learn these two skills most When the researcher asks them whether they are...
  • 44
  • 841
  • 0
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY

A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY

Khoa học xã hội

... difficult than what they have learnt and studied for the exam, others say that these test items are easy and relevant to what they have been taught Therefore finding out whether the tests are closely ... engage, the source of materials, the extent to which authentic materials may be altered, the response format and how responses are scored They are usually written before the tests and then the test ... Approach to language Pedagogy London: Longman Cotton, D , David , F and K Simon (2002) Market Leader- Pre-intermediate Longman Harrison, A (198 3a) A Language Testing Handbook London: McMillan...
  • 64
  • 1,112
  • 1
Vịnh Hạ Long - Điểm đến lãng mạn nhất Châu Á

Vịnh Hạ Long - Điểm đến lãng mạn nhất Châu Á

Tư liệu khác

... mặt nước Vịnh Hạ Long Còn gió ấm áp mang theo mùi hương hoa tươi, muối biển Và bạn tin vào câu chuyện thần thoại, thời điểm mà ngày, bạn nghe thấy tiếng thở dài tình nhân h a đá hang động Như câu ... nhiên xung quanh, thực đơn kết hợp hài h a ăn Pháp ăn Việt Nam Đảo nối với đất liền cầu dài 2km coi “Vườn đ a đàng”, không ngạc nhiên đảo Tuần Châu chọn đ a điểm đăng cai thi Hoa hậu Hoàn vũ ... bạn, ngày tàu Victory 04 khiến bạn ao ước có người đàn ơng bên cạnh giống quang cảnh xung quanh: đẹp trai với đơi nét “gồ ghề”, nam tính Còn “cướp biển vùng Caribbean” mẫu Johnny Depp lý tưởng bạn...
  • 2
  • 766
  • 0

Xem thêm