the long period theory of aggregate demand in a 1936 article by joan robinson1
báo cáo hóa học:" Long term outcomes of antiretroviral therapy in a large HIV/AIDS care clinic in urban South Africa: a prospective cohort study" docx
... demonstrates that rapid scale-up of HAART using a public health approach in sub-Saharan Africa, essential to confronting the HIV/AIDS epidemic, can be accompanied by high quality care The analysis of ... of CD4 counts, viral loads, and hemoglobin from the National Health Laboratory Service database into the TherapyEdge-HIV database demonstrated high quality of data entry as 98.8% of values matched ... antiretroviral therapy (HAART) has increased dramatically, but the majority of those in need remain untreated, especially in sub-Saharan Africa With more than five million individuals living with HIV and...
- 11
- 332
- 0
Báo cáo y học: " Fluorodeoxyglucose-positron emission tomography/computed tomography in the staging and evaluation of treatment response in a patient with Castleman''''s disease: a case report" pps
... allows a combination of both anatomical and biological co-registered images acquired in the same session, with a dual gain in diagnostic accuracy Staging is crucial in the identification of the appropriate ... literature and drafting the manuscript AC was involved in reviewing the literature and proofreading the manuscript VA approved the final manuscript Consent Written informed consent was obtained from the ... aggressive malignant lymphomas to characterise metabolically undetermined masses, tumour staging and restaging, treatment response evaluation and radiotherapy treatment planning In fact, it allows...
- 4
- 360
- 0
Báo cáo y học: "Secondary prevention of allergic symptoms in a dairy farmer by use of a milking robot" ppsx
... German Professionals insurance laws require a complete elimination of allergens for the recognition of an allergic airway disease as a compensable occupational disease Complete avoidance of occupational ... bronchial hyperresponsiveness was verified by a positive histamine inhalation challenge test The diagnosis of occupational asthma was confirmed by a separate specific inhalation challenge test using ... robot in 1999, i.e., an automatic milking system (AMS) At present circa 1300 AMS are installed, predominantly in the Netherlands, followed by Germany AMS were developed in the course of increasing...
- 4
- 279
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data ... general anesthesia Maternal death due to anesthesia is the sixth leading cause of pregnancyrelated death in the United States [6] and most anesthesia-related deaths occur during general anesthesia...
- 14
- 610
- 0
a theory of virtue excellence in being for the good dec 2006
... this same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords Private ... graduate seminars on virtue at Yale in the spring of 2000 and the fall of 2001, and at Oxford in the fall of 2004 As the preceding narrative may suggest, the number of discussants who have aided ... ‘normative ethics’ as a designation of the parts of ethical theory that are centrally engaged, in a general way, in actual ethical evaluation That is because ‘normative’ too easily suggests that the...
- 264
- 227
- 0
báo cáo hóa học:" The long-term benefit of computer-assisted surgical navigation in unicompartmental knee arthroplasty" doc
... statistical analysis and revisions of the manuscript; AJS conceived of the study All authors read and approved the final manuscript Page of Competing interests The authors declare that they have ... disagreements and 19 agreements The disagreements were in the adjacent zones and may represent the effects of weightbearing The mechanical axis crossed the tibial plateau at a mean or 42.63% of ... patterns of osteoarthritis of the knee joint in the community: The importance of the patellofemoral joint.” Annals of the Rheumatic Diseases 1992, 51(7):844-849 Ahlbäck S: “Osteoarthrosis of the...
- 5
- 405
- 0
báo cáo hóa học:" The long-term benefit of computer-assisted surgical navigation in unicompartmental knee arthroplasty" pptx
... statistical analysis and revisions of the manuscript; AJS conceived of the study All authors read and approved the final manuscript Page of Competing interests The authors declare that they have ... disagreements and 19 agreements The disagreements were in the adjacent zones and may represent the effects of weightbearing The mechanical axis crossed the tibial plateau at a mean or 42.63% of ... patterns of osteoarthritis of the knee joint in the community: The importance of the patellofemoral joint.” Annals of the Rheumatic Diseases 1992, 51(7):844-849 Ahlbäck S: “Osteoarthrosis of the...
- 5
- 512
- 0
Some Famous Problems of the Theory of Numbers and in particular pdf
... mathematics, and a little of the mathematical SOME FAMOUS PROBLEMS OF habit of mind which comes fully only after long years spent in the company of mathematical ideas Something, in short, may ... triangles of Pythagoras, and has been continued by a long succession of mathematicians, including Fermat, Euler, Lagrange, and Jacobi, down to the present day I will begin by a summary of what ... general nature of our THE THEORY OF NUMBERS 27 argument Imagine the unit circle as a thin circular rail, to which are attached an in nite number of small lights of varying intensity, each illuminating...
- 46
- 479
- 0
Báo cáo khoa học: "Targeted surveillance to assess the presence of BSE in the age risk population of cattle slaughtered in Bursa, Turkey: preliminary results of an immunohistochemical detection study for the 2004-2005 period" pdf
... gnidrocca deraperp seussit eht htiw ,dezilitu saw )ASU ,DRMV ;99/CHI -EST namlluP( 1.6.79/99F ydobitna lanolconom elbaliava yllaicremmoc a ,CHI eht roF gniniats E&H rof seussit fo noitaraperp eht ... elttac ksir-ta eht morf slamina citamotpmysa fo gnilpmas eht gnisaercni yb edam eb dluohs metsys ecnallievrus evitca eht gnidnapxe dna ecnallievrus evissap eht fo tnemevorpmi taht detats saw ti ,troper ... deilppa neeb sah ,lairetam deddebme niffarap dexif nilamrof ni cS-PrP fo noitceted eht rof dradnats nedlog a sa deredisnoc neeb sah hcihw ,CHI fo esu ehT shtnom 03 naht redlo slamina morf detcelloc...
- 3
- 237
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... running the project CR was responsible for the statistical analyses All authors interpreted the data and findings CR wrote the first draft of the manuscript, all authors read and approved the final ... between intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking...
- 9
- 367
- 0
báo cáo khoa học: "Sustained complete remission of human epidermal growth factor receptor 2-positive metastatic breast cancer in the liver during long-term trastuzumab (Herceptin) maintenance therapy in a woman: a case report" docx
... idea that continuing anticancer treatments as maintenance therapy in patients in remission or with stable disease may prolong the disease-free interval [8] There is an increasing number of case ... to eight years, and in all cases, maintenance therapy was based on trastuzumab One of these cases also illustrates the risk of withdrawing trastuzumab treatment when the patient had experienced ... will influence whether a patient achieves long- lasting remission on maintenance trastuzumab therapy We also speculate that the specific localization of breast cancer metastases may be a factor...
- 4
- 211
- 0
báo cáo khoa học: " The role of business in addressing the long-term implications of the current food crisis" docx
... exist in the Amazon or within Ayurvedic texts, or in the menu of options used by traditional healers of South Africa Business has the ability to bring these to scale and so in an ethically and ... additional factors, in causing the prices of soy beans, wheat and corn to increase over the past year The causes for increased food prices have been well described by the World Bank, many academics and ... could increasingly address the entire range of the agricultural investment climate, including access to micro-credit for small farmers, research on better seeds, training, provision of water saving...
- 5
- 317
- 0
Báo cáo y học: "Role of the long cytoplasmic domain of the SIV Env glycoprotein in early and late stages of infection" ppt
... GAAAAGCTGACCAATTATTCGGTAA, R – GCGACAGTTCAGCCATCACTT, P – 5'FAM – CCAACGCAAAGCAGTACATGAACTCATCC – TAMRA-3'; IL10: F – GTCATCGATTTCTTCCCTGTGAA R – CTTGGAGCTTACTAAAGGCATTCTTC P – 5'FAM – CCTGCTCCACGGCCTTGCTCTTG ... Tissue kit (Qiagen) and analyzed by RT-PCR RNA preparation and microarray analysis Total RNA was extracted from cells by using the Rneasy kit (Qiagen, Valencia, CA), according to the manufacturer's ... for inoculation of JC-53B cells The infectivity of particles was measured by removal of the media after days, fixation and staining of cells with X-gal The percent of particle infectivity was...
- 14
- 211
- 0
Báo cáo y học: " Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary" potx
... neurons in the ventral tegmental area (VTA) allows them to release dopamine in the NAc and (via amygdala) in certain parts of the hippocampus, permitting the completion of the cascade and the development ... met-enkephalin in the ventral tegmental area, which inhibits the activity of neurons that release the inhibitory neurotransmitter gamma-aminobutyric acid (GABA) The disinhibition of dopamine-containing ... that could impact the brain in a negative manor Impairment of the brain reward cascade ultimately leads to a reduction of net DA release, a reduction in dopamine receptors and as such an enhancement...
- 16
- 405
- 0
The long term effects of behavioral interventions on condom use and sexually transmitted infections among female brothel based sex workers in singapore, 1994 2002
... evidence of a rebound and increase in STIs and HIV, after having seemingly declined in the late eighties and early nineties, This is partly attributed to the introduction of antiretroviral therapy in ... biggest killer in the world and the leading cause of death among males in Sub-Saharan Africa.1 AIDS affects the young and economically productive group and hence has a profound impact on the economy ... 2 Brothels in Singapore Front of a brothel The interior of a brothel Back alley of a brothel where clients gather A room in the brothel 18 Brothel-based sex workers An estimated number of 1,100...
- 190
- 382
- 0
THE SURROUNDED ATOM THEORY OF ORDER DISORDER PHASE TRANSITION IN BINARY ALLOYS
... is measured by the parameter [1-3]: f − CA (1) η = Aa − CA where fAa means the fraction of A atoms in the a sublattices and Cα (α = A, B)is the fraction of αatoms in the crystal In this way η ... considered as the interaction energy between Z pairs AA and Z pairs AB The interaction energy between a pair AA V (Z)−V and Z pairs AB is equal to A Z A The interaction energy between a pair AA and ... be the coordination number of the lattice, N - the number of lattice sites and NA and NB - the number of A and B atoms, respectively Each A- site has ZAA nearest neighbours A- atoms and ZAB nearest...
- 7
- 265
- 0
Long run effects of government policy in the growth model with creative destruction
... , and the other part is a dynamic one solving the optimal time paths of variables such as per capita capital asset, leading-edge productivity and variety of intermediate goods 4.1 Steady-State ... wage induced by the increasing scarcity of labor in final sector, and the effect of population growth to vertical innovator’s profit − g L 22 For nt > , putting equation (12) into the vertical innovator’s ... Stationary is also imposed on the fraction of Qt At Qt At Qt At final output allocated to vertical R&D nt , the fraction of final output allocated to horizontal R&D ht , and interest rate rt In...
- 79
- 265
- 0
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
... 28 in total and 13 m2 green area per person: one in the north, one in the east and the last one in the west of Linh Dam area Among them, the eastern park (located in the peninsula) is the biggest ... the area There is only one public parking area at a reasonable and position - closed to the main axis Parking in residential areas is generally organized in the ground floors of apartment buildings ... follows the main transportation axes connecting the inner city to neighboring areas, while the administrative boundaries have expanded in other directions The Master plan of Hanoi was approved in...
- 10
- 805
- 3
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
... đảm bảo vệ sinh để lao động bán hàng rong, chờ việc chợ lao động có đ a điểm làm việc cụ thể Họ rong ruổi khắp đường, ngõ phố, hạn chế vấn đề tai nạn giao thông, trật tự an ninh mỹ quan đô thị ... họ mua bảo hiểm y tế Nâng cao đời sống tình thần: Thông qua tổ dân phố, ủy ban nhân dân phường tổ chức buổi sinh hoạt văn nghệ, buổi giao lưu, vui chơi giải trí v a phục vụ, v a vận động lao động ... kéo theo điều kiện sống mức tối thiểu, tạm bợ khu nhà trọ rẻ tiền với điều kiện sinh hoạt an ninh không đảm bảo Đời sống tinh thần lao động hạn chế Họ thấy cô đơn, nhớ gia đình Các hoạt động giao...
- 8
- 654
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25