the balance of payments account is a record of

... around the fortifications near Helles and the villages of Krithia, Kurija Dere, Biyuk Anafarta, and Anafarta Sagir. On the side nearer Asia, Maidos, Galata, and Gallipoli boasted the status of ... that as soon as another ship, then at the wharf, had cleared, the troops were to disembark and journey by train to a camp near Cairo. In preparation a small advance party of three officers and ... Cairo, Tel-el-Kebir, and the Pyramid, I have especially to thank Captain E. A. E. Andrewartha of the Australian Staff Corps. The publication of the Nominal Rolls of Members of the Battalion has...

Ngày tải lên: 21/02/2014, 08:20

... oligo- merization domain (i.e. b sheets 7 and 8, the AAA domain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA ... domain helix and the C-terminal helix, but not the b domain. The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, which dif- fers from that of other AAA ATPases ... material is available online: Fig. S1. Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species. This material is available as part of the online article from...

Ngày tải lên: 07/03/2014, 05:20

... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... cerato-platanin domain, and a blastp search always yielded the members of the cera- to-platanin family as the best hits. It is possible that they represent an ancestral cerato-platanin member that is ... confrontation assays, osmotic stress and starva- tion. Although the TrichoEST database comprises ESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of H. jecorina is available,...

Ngày tải lên: 07/03/2014, 12:20

...  ARRIVAL FROM DELAWARE, 1858.  ARRIVAL FROM DELAWARE, 1858.  ARRIVAL FROM MARYLAND, 1858.  ARRIVAL FROM NORTH CAROLINA AND DELAWARE.  ARRIVAL FROM MARYLAND.  ARRIVAL FROM MARYLAND. ... in Paducah jail, and there claim such reward as may be offered by the master. this quarter, which may account for the fact of "Miller's" knowledge of the whereabouts of the ... the North; any planter's house entertains travelers occasionally. One night I stayed at a medical gentleman's, who is not a large planter; another night at an ex-magistrate's house...

Ngày tải lên: 15/03/2014, 03:20

Ngày tải lên: 22/03/2014, 17:20

Ngày tải lên: 23/03/2014, 12:20

Ngày tải lên: 04/06/2014, 12:23

Ngày tải lên: 13/07/2014, 23:26

... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... scene have the same color temperature. A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation. Most cameras can adjust automatically to ... near the subject and pointed toward the camera. The minimum acceptable level for color television depends on the ability of the lens to transmit light to the camera, the sensitivity of the...

Ngày tải lên: 26/01/2014, 04:20

... raɪz nju ː w ɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ru ːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn bi ː ə pi ːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt bi ː ə ... want to improve my English! Many people are worried about learning English. ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ They think English is difficult and it’s hard to memorize new...

Ngày tải lên: 27/01/2014, 20:11

... es la selección de las variables antropométri- cas más adecuadas para caracterizar poblaciones sanas de personas mayores. Para ello se han seleccionado aleatoria- mente 1030 de estas personas ... nificant factors (with eigenvalues greater than unity) that are capable of explaining 94.5% of the variance and thus most of the infor mation in the original data set. The new “latent” factors are ... Chemistry. Faculty of Sciences. University of Valladolid. Valladolid. Spain. SELECCIÓN DE LAS VARIABLES ANTROPOMÉTRICAS MÁS ADECUADAS PARA CARACTERIZAR UNA POBLACIÓN DE PERSONAS MAYORES SANAS Resumen El...

Ngày tải lên: 05/03/2014, 21:20

... structures of PolIIIs-V and DnaA-I adopt a vari- ant of the so-called type II KH fold [21]. One of their major differences from classical type II KH domains is the absence of the characteristic GXXG ... The actual DNA synthesis is performed by the catalytic a- subunit (PolIIIa), which belongs to the C-family of DNA polymerases [2]. Polymerases of the C-family fall into two major groups, DnaE and ... III and interaction with the alpha subunit. Nucleic Acids Res 35, 2825–2832. 20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T & Ueda T (2007) Structure and function of DnaA N-terminal domains:...

Ngày tải lên: 05/03/2014, 23:20

... within a common law legal order which they make sense of in accordance with the rigid doctrine of theseparation of powers; and, finally, functionalism, a theory of the administrative state that seeks ... doubtful. The issue is not only or even mainly that Smuts was a racist, whose own policies in South Africa laid the basis for apartheid: after all, in holding racist views, he was in the mainstream of ... second, the legislature seeks to create a hole that is grey rather than black, one in which there is the fac¸ade or form of the rule of law rather than any substantive protections. As we will see, the...

Ngày tải lên: 07/03/2014, 02:20

... will call the rigid doctrine of the separation of powers. This is the doctrine that asserts that the legislature has a monopoly on law-making, the judiciary amonopolyoninterpretation of the law, ... in maintaining the rule of law. Chapter 4,‘Theunityof public law’, weaves the threads of the entire argument of the book together viaadiscussion of the relationship between international human ... severity of the emer- gency. Rather, they are detained because it is alleged that they fall into the category of ‘enemy combatants’, a category which is beyond the reach of both domestic and international...

Ngày tải lên: 07/03/2014, 02:20

... inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT Table 1. Primers and probe sets ... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT p21 WAF1/CIP1 Cyclin-dependent ... sequence of CARP was obtained by PCR amplification using mouse cDNA extracted from muscle of a 129SvTer mouse as a template. The primers used were 5¢-CACCATGATGGTACTGAGAG-3¢ and 5¢-GAA TGTAGCTATGCGAGAGTTC-3¢....

Ngày tải lên: 07/03/2014, 03:20

... 43 CHAPTER IV 45 DATA ANALYSIS 45 Introduction 45 Summary Statistics 45 Analysis at the Organizational-Level 50 Results of Factor Analysis 58 Results of Reliability Test 59 Analysis for ... and data analysis. This research involves using a variety of sources to collect data as well as quantitative and qualitative methods for analyzing the data. The data on effectiveness of supplier ... components analysis, cluster analysis and smallest space analysis have identified these three underlying factors or empirical clusters (Cooke & Lafferty 1982/1989). Clinical analysis of organizations,...

Ngày tải lên: 16/03/2014, 03:20

... Brennan PJ & Chat- terjee D (2001) The role of the embA and embB gene pro- ducts in the biosynthesis of the terminal hexaarabinofuranosyl motif of Mycobacterium smegmatis arabinogalactan. ... phosphorylation affects two important physiological phenomena, namely the Lipoarabinomannan ⁄ Lipomannan (LAM ⁄ LM) ratio, which is an important determinant of mycobacterial virulence and resistance ... mycobacterial transcriptional activator, EmbR, is essential for transcriptional regulation of the embCAB operon encoding cell wall arabinosyltransferases. This signaling pathway eventually affects...

Ngày tải lên: 16/03/2014, 14:20

... cells, autophagocytosis is imperfect, thereby initiating the age-related accumulation of garbage. Given this, it is reasonable to expect a further decrease in autophagocytotic capacity at old age and ... recycling mechanisms are inherently imperfect [15,25], and this may provide an attractive explanation for many of the features of aging. A number of early explanations of aging, such as Orgel’s error catastrophe ... Georgetown, Texas. 25. Brunk, U.T. & Terman, A. (1999) The mitochondrial-lysosomal axis theory of cellular aging. Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas,...

Ngày tải lên: 17/03/2014, 23:20