a metabolic pathway is a chain of chemical reactions
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... only as a carbon source, but also as a nitrogen source for g rowth of the assimilating bacteria. Deaminases, which catalyze the release of ammonia, are a key enzyme in the metabolic pathways of ... to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Jap an. Recently, we reported the cloning and s equencing ... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) w as from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx
Ngày tải lên: 29/03/2014, 23:20
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table 2). Except for Ang-2 ... optimal cut-off values. Data are displayed as median and range (minimum to maximum) unless otherwise stated. All statistical analyses were performed with the SPSS Table 1 Demographic, clinical and ... Systems, Minneapolis, USA). This assay measures biologically active VEGF 121 and VEGF 165 . Statistical analysis Differences between patients and healthy controls were eval- uated using a non-parametric...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth Analg 2005, 101:1470-1476. 28. ... acquisition of data. NM helped to draft the manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the study. AAZ participated in the design of the study, and ... the analyzer Cobas Integra (Roche Diagnostics, Mannheim, Germany). The limits of detection were 0.071 mg/dl. Statistical analyses Data are presented as the mean ± standard deviation for vari- ables...
Ngày tải lên: 25/10/2012, 10:35
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
... than, a decade ago. (A) equally as prevalent, if not more so than, a decade ago. (B) equally as prevalent, if not more so than, it was a decade ago. (C) as prevalent, if not more than a decade ... duplicate com- pared to the cost of developing and marketing the software. The actual cost of duplicating a software program, which may have a retail value of $400 or more, can be as little as a ... as any candidate in the state’s history. (B) she had been reelected with as wide of a margin as any candidate in the state’s history. (C) having been reelected with as wide a margin as any candidate...
Ngày tải lên: 20/01/2014, 20:20
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx
... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... see cameras advertised as 2 LUX or 4 LUX cameras. 2 LUX is equal to .19 foot candles. 4 LUX is about .37 foot candles. I was suspicious, so a number of years ago I set up an ordinary candle ... foot away from a white square on a black background. I tested two cameras. The first was a popular CCD camera requiring four LUX for minimum illumination. The second was a broadcast camera using...
Ngày tải lên: 26/01/2014, 04:20
Learning english is a piece of cake 1
... raɪz nju ː w ɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ru ːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn bi ː ə pi ːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt bi ː ə ... http://langmaster.edu.vn | Crazy English Trainers: WaNo: 01653.994.122 | Chuẩntt : 0985.82.87.87 In fact, she is a sales person! 7. “Improve” = cải thiện, cải tiến. I want to improve...
Ngày tải lên: 27/01/2014, 20:11
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This project was supported by grants from the Aus- trian Science ... ACTIN2 gene as an internal standard. PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... Yasuda T (2002) Activation of AtMEK1, an Ara- bidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed in E. coli and generation of the active...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily detectable amounts of an intermediate of d 1 synthesis. Experimental procedures DNA manipulations DNA ... 25 2.2 2 1.8 1.4 1.2 1.6 1 0.8 0.6 0.4 0.2 0 A 600 A 600 A 600 Time (h) Fig. 5. His41 is essential for Paracoc- cus pantotrophus NirF, but Asp129 is dis- pensable. Growth plots and time courses of nitrite appearance and disappearance ... d 1 heme lacking iron and ⁄ or with the side chain satu- rated, but accessing these putative substrates is not trivial. An alternative approach would be to seek accu- mulation of the substrate of NirF...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ... overall CMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV (4) TOP-ARS-β-gal 5’-ccttctccccggcggttagtgctgagagtgc-3’ ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa S. Ma et al. PABP expression during heat shock recovery FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT pEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG pYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2...
Ngày tải lên: 19/02/2014, 05:20
Bạn có muốn tìm thêm với từ khóa: