... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... see cameras advertised as 2 LUX or 4 LUX cameras. 2 LUX is equal to .19 foot candles. 4 LUX is about .37 foot candles. I was suspicious, so a number of years ago I set up an ordinary candle ... foot away from a white square on a black background. I tested two cameras. The first was a popular CCD camera requiring four LUX for minimum illumination. The second was a broadcast camera using...
Ngày tải lên: 26/01/2014, 04:20
... raɪz nju ː w ɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ru ːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn bi ː ə pi ːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt bi ː ə ... http://langmaster.edu.vn | Crazy English Trainers: WaNo: 01653.994.122 | Chuẩntt : 0985.82.87.87 In fact, she is a sales person! 7. “Improve” = cải thiện, cải tiến. I want to improve...
Ngày tải lên: 27/01/2014, 20:11
Learning Patient-Specific Cancer Survival Distributions as a Sequence of Dependent Regressors docx
... 2E8 {chunnam,rgreiner,hsiuchin}@ualberta.ca Vickie Baracos Department of Oncology University of Alberta Edmonton, AB T6G 1Z2 vickie.baracos@ualberta.ca Abstract An accurate model of patient survival time can help in the treatment ... Logistic regression, survival analysis, and the Kaplan-Meier Curve. Journal of the American Statistical Association, 83(402):414–425, 1988. [14] D. Gamerman. Dynamic Bayesian models for survival ... lung cancer that s/he has a 50% 5-year survival rate. In general, today’s cancer survival rates and median survival times are estimated from a large group of cancer patients; while these estimates...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT p21 WAF1/CIP1 Cyclin-dependent ... inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT Table 1. Primers and probe sets ... A & Kandarian SC (2003) Global analysis of gene expression patterns during disuse atrophy in rat skeletal muscle. J Physiol 551, 33–48. 12 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y, Tanaka...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... [e.g. cerato-platanin of Ceratocystis fimbriata f. sp. platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path- ogenesis-related proteins (As-CG of ... Stability of clades was evaluated by 1000 bootstrap rearrangements. Bootstrap values lower than 20% are not displayed in the cladogram. RNA isolation and hybridization Fungal mycelia were harvested ... helices, separated by a 14 amino acid strand. interproscan analysis [22] of Epl1 showed the affi- liation of this protein to the cerato-platanin family (IPR010829). This is a group of low molecular weight, 4-cysteine-containing...
Ngày tải lên: 07/03/2014, 12:20
Thumbnailing for Animation Thumbnails from a sequence of Disney’s Rescuers pdf
... www.animationmeat.com 15 The Art of Thumbnailing Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 28 The Art of Thumbnailing Preparing for Animation: The Art ... www.animationmeat.com 35 The Art of Thumbnailing Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 27 The Art of Thumbnailing Preparing for Animation: The Art ... www.animationmeat.com 26 The Art of Thumbnailing Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 11 The Art of Thumbnailing Preparing for Animation: The Art...
Ngày tải lên: 08/03/2014, 11:20
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... Shown is the residual PknH- and EmbR-associated radioactivity. Each value is the average of two individual reactions and representative of three experiments. K. Sharma et al. Regulation of EmbR activity ... mycobacterial transcriptional activator, EmbR, is essential for transcriptional regulation of the embCAB operon encoding cell wall arabinosyltransferases. This signaling pathway eventually affects ... biochemical characterization revealed that EmbR, as a transcriptional regulator, inter- acts with RNA polymerase and possesses a phosphorylation-dependent ATPase activity that might play a role...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
... primer 5¢-GA GAATTC TCG CAG AGC GGG GAG GAG AAC-3¢ and antisense primer 5 ¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG-3¢. The PCR product was ligated to pGEM-T (Promega) by T -A cloning. After the ... Tris ⁄ HCl-injected striata and CL uninjected striata from Tris ⁄ HCl-injected rats. A 60 kDa band was present in KA-injected striata (Fig. 1E); this band was much weaker in CL striata, and was ... in areas adjacent to sites of KA injection, and not in the contralateral (CL) striatum (Fig. 1C,D). To confirm that the increased expression of BNIP3 after KA administration was caused by activation...
Ngày tải lên: 22/03/2014, 17:20
A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc
... from the market may also restrict the nature and degree of organizational change or adaptation in organizations (Hannan and Freeman, 1984). Research on organizational change has led to various ... characteristics of change. Change is defined as a movement away from a current state toward a future state (George and Jones, 1995). In the organizational change literature, at the abstract ... unconscious aspect of attitude. The key proposition of this stream of research 19 change. That is, humans usually try to make sense of what has happened, what is happening, and what will happen. A...
Ngày tải lên: 23/03/2014, 04:21
This pdF is a sample of the trend database & Monthly Snapshot potx
Ngày tải lên: 23/03/2014, 12:20
krafft carl - gravitation is a function of the aether vortex proton
Ngày tải lên: 04/06/2014, 12:23
báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf
Ngày tải lên: 19/06/2014, 22:20
101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx
Ngày tải lên: 28/06/2014, 12:20
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx
Ngày tải lên: 28/06/2014, 17:20
THE SENTENCE (A sentence is a group of words which expresses a complete thought.)
Ngày tải lên: 13/07/2014, 23:26
what is clause (A clause is a group of words that contains a subject and a finite verb)
Ngày tải lên: 13/07/2014, 23:27
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... the first amino acid of strand A (Y9) and the last amino acid of strand G (K87) . The elongation of the x(Y9)Àx(87) distance up to the transi- tion state is defined as the distance Dx A ÀG . The ... constant velocity and constant force SMD. Acknowledgements We are grateful to Sergi Garcia-Manyes for careful reading of the manuscript and Pallav Kosuri for assistance in figure preparation. This work was ... the first amino acid of strand A (Y9) and the last amino acid of strand G (K87). This distance, x(Y9) Àx ACHTUNGTRENNUNG(K87), increases as the two b-strands separate under a constant force...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... Although A B MYB2 MYB3 MYB4 MYB5 E2F CAAT CAAT CDE CHR MYB1CHR ABCDE GHIF ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTTAAGATCT CHRup MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut E Mut F Mut G Mut H Mut I ABCDEFG H I–...
Ngày tải lên: 23/03/2014, 04:20