the development of written languages were a result of

... explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic errors [26,27]. Adequate support for ... 774–779. 48. Yoneda, M., Chomyn, A. , Martinuzzi, A. , Hurko, O. & Attardi, G. (1992) Marked replicative advantage of human mtDNA car- rying a point mutation that causes the MELAS encephalomyo- pathy. ... maintenance. Mitochondria are the main source of ROS formation, as well as the main target for free radical attack. The accumulation of defective mitochondria within aging cells suggests that some are not properly autophagocytosed. Aged...

Ngày tải lên: 17/03/2014, 23:20

... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 ... number MAP1b-for MAP1b-rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG 82898–82923 83581–83552 NC_000076 Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067...

Ngày tải lên: 23/03/2014, 05:22

... nificant factors (with eigenvalues greater than unity) that are capable of explaining 94.5% of the variance and thus most of the infor mation in the original data set. The new “latent” factors are ... Valladolid. Valladolid. Spain. SELECCIÓN DE LAS VARIABLES ANTROPOMÉTRICAS MÁS ADECUADAS PARA CARACTERIZAR UNA POBLACIÓN DE PERSONAS MAYORES SANAS Resumen El objetivo es la selección de las variables antropométri- cas ... null hypothe sis of spherical distribution of the original vari- ables can be rejected and the FA can be used to reduce the dimen sionality of the data set. Table VI shows the results of the FA, based...

Ngày tải lên: 05/03/2014, 21:20

... III and interaction with the alpha subunit. Nucleic Acids Res 35, 2825–2832. 20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T & Ueda T (2007) Structure and function of DnaA N-terminal domains: ... Zawilak-Pawlik A, Kapp U & Terradot L (2009) The structure of a DnaA ⁄ HobA complex from Helicobacter pylori provides insight into regulation of DNA replication in bacteria. Proc Natl Acad ... The actual DNA synthesis is performed by the catalytic a- subunit (PolIIIa), which belongs to the C-family of DNA polymerases [2]. Polymerases of the C-family fall into two major groups, DnaE and...

Ngày tải lên: 05/03/2014, 23:20

... he was a member of the Imperial War Cabinet during the First World War, played a significant role in the foundation of the League of Nations, and was made Chancellor of the University of Cambridge. ... constitution exhibits the values of a substantive conception of the rule of law and that these values make the exercise of legal authority legitimate. At one level, then, my ambition is to sketch the basis for a ... on an appeal from Pondoland. I asked the date, and he gave me the date within six months. I turned up the Reports and found that he was right in every particular, and a page and a half of that...

Ngày tải lên: 07/03/2014, 02:20

... conception of the rule of law. For they maintain that they are upholding the rule of law when at most there is rule by law, a statutory warrant for the executive. Iwill then set out the view that in fact ... determine the content of the law in accordance with the aspirations of (ideal) legal order; and the legislature and the executive have exactly the same duty. It is not, I must hasten to add, that the ... interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality. My main focus was on the statutory regime put in place to maintain national...

Ngày tải lên: 07/03/2014, 02:20

... quantitative and qualitative orientations. These approaches were developed in several fields, and they were, to a large degree, an outgrowth of the popularization of triangulation methods (Tashakkori ... types of triangulation: 1. Data Triangulation- the use of a variety of data sources in a study. 2. Investigator Triangulation – the use of several different researchers. 3. Theory Triangulation ... 45 DATA ANALYSIS 45 Introduction 45 Summary Statistics 45 Analysis at the Organizational-Level 50 Results of Factor Analysis 58 Results of Reliability Test 59 Analysis for Individual Units...

Ngày tải lên: 16/03/2014, 03:20

... is located at the new N-terminus of the protease domain, undergoes a large movement towards the activation pocket of FXIa. As a result, in the structure of FXIa [25], the surface area of Val371 ... 88, 2611–2618. 30 Solera J, Magallon M, Martin-Villar J & Coloma A (1991) Identification of a new haemophilia BM case produced by a mutation located at the carboxy terminal cleavage site of activation peptide. ... FXI-deficient plasma as sub- strate (Hemoliance, Salt Lake City, UT). FXI antigen was measured by an ELISA based on a goat anti-human FXI affinity purified IgG as capture antibody and a goat anti- human FXI...

Ngày tải lên: 23/03/2014, 07:20

... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in M. capsulatus O. A. Karlsen ... CCP-similar core. A similarity search against the translated GenBank nucleotide database (tBLASTn) revealed significant similarity between MCA2590 and an unannotated ORF of Methylomicrobium album ... centrifugation (Amicon, 10 kDa cut-off) and the polypeptide migra- ting with an apparent molecular mass of 80 kDa in the SDS ⁄ PAGE analysis of the concentrate was excised from the gel and subjected to MS analyses...

Ngày tải lên: 23/03/2014, 11:20

... from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart. References Argue, J. (2000) Parkinson’s disease and the art of ... Responses The tango group stated on the exit questionnaire what they liked best and least about the program. They greatly appreciated the camaraderie and socialization engendered by the program. Being ... together with others like them because of the supportive and therapeutic aspects. They requested that they have lunch together at the end of the sessions. During the dance classes, they were...

Ngày tải lên: 28/03/2014, 20:20

... area. This led to 14 possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha) B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, ... bold): B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, A A B (Table 1). In summary, eight of the 14 possible combinations could be assigned by NMR, as illustrated ... by the a- Fuc3NAc(1fi2) a- Rha disaccharide. The conclusion is that b-Rha could be assigned in the following combinations (the assigned b-Rha are in bold): A- B A A/ B, A- B A A/ B, A- B A AandA–B A A. (Table...

Ngày tải lên: 31/03/2014, 09:20

... the king of the asuras. This chapter represents a Buddhist adaptation of what is often referred to as the våmana-avatåra of the Vai˚¶avite tradition, the story of Vi˚¶u’s appearance as a våmana, ... he is a manifestation of Maheßvara, Nåråya a or the råk˚asa Råva a: the last of these three is, of course, the name of the great demon of the Råmåya a who captures and carries off Sƒtå, Råma’s ... conversion story of the Sarvatathågata- tattvasaµgraha, Íiva is then identified as the tathågata Bhasmeßvara, or “Lord of Ashes.” This is an allusion to the predeliction of Íiva (and the Íaivite yogin) for...

Ngày tải lên: 11/06/2014, 12:47

... 5'-GTCCCTACAATGGCACAAGG-3' R: 5'-GGTTCATCAGCATCCGAGTAG-3' JUN F: 5'-GAGCGGACCTTATGGCTACA-3' R: 5'-TGAGGAGGTCCGAGTTCTTG-3' FOS F: 5'-CAAGCGGAGACAGACCAAC-3' R: ... 5'-CAAGCGGAGACAGACCAAC-3' R: 5'-GAGCTGCCAGGATGAACTC-3' HSPB8 F: 5'-AGCCAGAGGAGTTGATGGTG-3' R: 5'-TGCAGGAAGCTGGATTTTCT-3' GAPDH F: 5'-GAGTCAACGGATTTGGTCGT-3' R: 5'-TTGATTTTGGAGGGATCTCG-3' * ... the analysis of serum samples. The microarray experiment and the analysis of array data were carried out by Almac Diagnostics, Craigavon, N. Ireland. PMW was responsible for the annotation of the...

Ngày tải lên: 18/06/2014, 16:20

Ngày tải lên: 19/06/2014, 15:20

Ngày tải lên: 19/06/2014, 15:20

Ngày tải lên: 19/06/2014, 22:20

Ngày tải lên: 20/06/2014, 04:20

Ngày tải lên: 20/06/2014, 07:20

Ngày tải lên: 20/06/2014, 07:20