the association of epstein barr virus ebv with t cell lymphoproliferations and hodgkin apos s disease two new developments in the ebv field
báo cáo khoa học: " Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report" docx
... though it was of T- cell origin, which is only seen in a small minority of patients [12] The initial step in treating PTLD is reduction in immunosuppression, and the response is usually seen in three ... management involved reducing the dose of the patient s immunosuppressive agents and starting chemotherapy Administration of azathioprine, prednisone and tacrolimus was stopped and low dose sirolimus ... lymphoma, with an unusual presentation of acute appendicitis and EBV positivity We report successful treatment with chemotherapy and stress the need for heightened awareness of this malignancy in patients...
- 8
- 202
- 0
Báo cáo y học: "Sequence analysis of the Epstein-Barr virus (EBV) BRLF1 gene in nasopharyngeal and gastric carcinomas" docx
... dominant in the specimens observed In this study, subtype BR1-C was seen more in biopsies of NPC It can be speculated that a substrain of EBV with this subtype infects NPC more frequently and this subtype ... contributions YPJ carried out most of the studies and drafted the manuscript YW and YC participated parts of the studies and writing YZJ was responsible for the collection of specimens used in this study ... for the populations in Southern China Interestingly, a silent mutation A®G at 103654 was found in all the wild isolates, suggesting this interchange may be a specific marker of the EBV strains in...
- 8
- 348
- 0
báo cáo hóa học:" Clinical values of multiple Epstein-Barr virus (EBV) serological biomarkers detected by xMAP technology" potx
... populations, such as the high-risk NPC families, the nonendemic healthy controls and patients with other EBVassociated diseases Methods and Materials Study populations A total of 547 NPC patients and ... life-long persistent infection without serious consequences in most of populations, but a number of documents showed that EBV infection was involved in many diseases, including Hodgkin' s disease (HD) ... levels of each EBV marker between any group of the patients and Cantonese controls EBV serological profiles in patients with other EBVassociated diseases We further analyzed these EBV antibodies in...
- 8
- 478
- 0
Báo cáo y học: " Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye" pps
... done to minimise the necessity for two separate EBV standards, thus reducing costs and labour The EBNA-1 and BHRF-1 DNA targets were linked using randomised primers (Table 1) and inserted into the ... international calibration standard could be the first step towards standardisation [73] However, instrumentation, chemistries, gene targets and other test-related aspects remain diverse One solution ... quantification of EBV and other viruses [27,74,75] Conclusion This is the first reported study that uses the SYBR Green I dye on the Rotor-gene 6000™ with a novel quantification standard containing two...
- 11
- 323
- 0
Báo cáo hóa học: " Secretion of Epstein-Barr Virus-encoded BARF1 oncoprotein from latently infected B cells" doc
... AKATA cells This is contrarly to their transcription, although BARF1 quantity could not be quantified by actin standard marker due to their secreted protein statue We demonstrated in this study the ... during tumor development [21] Competing interests The authors declare that they have no competing interests Authors' contributions SF contributed to perform the experiment TO contributed to design, ... limited to epithelial cells, but also in B cells Figure latently infected AKATA and IB4 cells Transcriptional and translational expression of BARF1 in Transcriptional and translational expression...
- 4
- 271
- 0
Báo cáo y học: "Possible roles of Epstein-Barr virus in Castleman disease" potx
... evaluate the role of EBV in both tumor parts and nontumor parts of each patient Conclusion Epstein- Barr virus is highly associated with Castleman disease More EBV- positive cells in germinal centers ... contributions CH Chen is the main author to design the study, write the article and submit the manuscript TT Hung helped analyze the results of the study HC Liu and TP Liu participated in reviewing the ... curative resection, strategy for anti-angiogenesis may have a potential role to control the disease Competing interests The authors declare that they have no competing interests Authors' contributions...
- 5
- 316
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... MSCs)/radioactivity in cultures without MSCs]) by increasing numbers of MSCs is shown Each result represents the mean of four cultures ± standard error of the mean (SEM) Results are representative of two independent ... cyclo-oxigenase-2 To investigate the immunosuppressive potential of MSCs in vitro, we tested their effect on the anti-CD3induced proliferation of CD4+ T cells T cells were stimulated in vitro with anti-CD3 ... harvested by incubation with trypsin/EDTA and counted MSCs were washed with PBS 2% FCS, stained with the indicated antibodies for 30 minutes and washed twice with PBS 2% FCS For the biotin-conjugated...
- 11
- 464
- 0
báo cáo hóa học:" Health-Related Quality of Life in Parkinson disease: Correlation between Health Utilities Index III and Unified Parkinson’s Disease Rating Scale (UPDRS) in U.S. male veterans" docx
... manuscript draft Competing interests The authors declare that they have no competing interests GFK had full access to all of the data in the study and takes responsibility for the integrity of the data ... the relatively short duration of study, and perhaps also the fact that notwithstanding the decline in status expected with a degenerative disease Page of like PD, at least some subjects may have ... assess the relationship between health utility scores and PD severity as measured using standard disease- specific tools In cross-sectional analyses, we identified ADL-related components of the...
- 9
- 490
- 1
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... 0.6 0.8 the on-state (this amounts to stimulation by a factor of 9.7) Thus, the background in the off-state was much lower with pEBTetD than with pEBTet However, in contrast to expression of membrane ... utilize continuous expression of the unmodified TetR The original tetracycline repressor simply binds to a tandem of the type tetracycline operator (tetO2) operator and thus blocks transcription ... expression into the target site Since the open reading frame for hygromycin resistance on the expression plasmid lacks a start codon, random integration into the genome does not yield resistant cells This...
- 8
- 331
- 0
Báo cáo y học: "Effect of methotrexate and anti-TNF on Epstein-Barr virus T-cell response and viral load in patients with rheumatoid arthritis or spondylarthropathies" ppt
... population All studied subjects were seropositive for EBV The present study consisted of two parts In the cross-sectional first part of the study we investigated EBV- specific IFNγ-producing T cells ... Statistical analysis Results are given as the percentage of patients with positive EBV T- cell response, as well as the mean response ± standard deviation Statistical analyses involved use of StatView 5.0 ... differences between patients and control individuals in the proportion of subjects with positive EBV- specific IFNγ-producing T cells in PBMCs, the mean number of SFCs or the SFC distribution Two studies...
- 9
- 471
- 0
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... membranes of these joints showed mild synovial and lymphoid proliferation These findings were compatible with the pathological findings of RA joints Discussion To the best of our knowledge, this is the ... Japan, and has a cysteine derivative possessing two SH-groups Its antirheumatic effects are thought to arise from its suppression of the formation of IgM in B cells, the formation of matrix metalloproteinase-3, ... population of lymphocytes was small and there was almost no staining for EBER in the BM The spleen tissue also showed diffuse infiltration of myeloblasts, and rare EBER-positive lymphocytes In contrast,...
- 6
- 314
- 0
Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx
... suggested to indicate possible genetically determined defects in T cell responses to EBV in certain populations Our review of Western cases showed that four of those 14 patients developed a T ... clinicopathological features of fulminant T- LPD that arose in the setting of acute primary EBV infection in our patient, characterized by a monoclonal proliferation of EBV- infected T cells Case presentation A ... not reported TCRa presented with clonal rearrangements in nine out of 10 patients and EBV genome was clonal in all but one case In contrast, among patients with T cell LPD after CAEBV infection...
- 5
- 379
- 0
The development of an in vivo humanized mouse model to investigate epstein barr virus infection and tumorigenesis
... germinal centers in infectious mononucleosis causes the infection of bystander germinal center cells, pushing them into the latency III growth program and these constitute the majority of the cell ... patient and the intensity of the immunosuppressive regime used The highest rate of PTLD is seen in the first year post- transplant124 The overall incidence of PTLD is - 2% The incidence of the ... immune response of immunosuppressed patients is not optimal so serology tests should be interpreted with caution The major role of EBV serology in the transplant setting is to determine the serological...
- 191
- 634
- 0
Báo cáo hóa học: " Epstein-Barr virus encoded latent membrane protein 1 regulates mTOR signaling pathway genes which predict poor prognosis of nasopharyngeal carcinom" pot
... (AP-1) and employing Janus kinases (JAKs) or and signal transducers and activators of transcription (STATs) (JAK/STAT) pathways and regulate their substrates[6] LMP1 also targets the phosphatidylinositol-3-kinase ... WHO type, TNM stage, T stage, N stage, recurrence and metastasis) Competing interests The authors declare that they have no competing interests Authors' contributions JC carried out substantial ... the intensity of staining and percentage of tumor cells stained Staining intensity was scored as = negative, = weak, = moderate, = strong The percentage of tumor cells stained was scored as =...
- 9
- 355
- 0
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx
... GAGTTGTCCTACATGCAAGTACATGTTTTTAATGTTGTCTGTCTTCTGTGCT GTTCCTGTAAGTTTGCTA GTAGCTGCCTGCATAGGAGCCTCGCTTCCGATTATTCCCTTCCCAATATTAT TCATCCAGACTTAGCCAC GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA ... CCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAA GTACTCCGTGTGGATCGGCG CTCGGCTCACTGCAAGCTCTGCCTCCCAGGTTCACACCATTCTCCTGCCTC AGCCTCCCGAGTAGCTGGG CATGCAAGTTGGCAGTGGTTCTGGTACTAAAAATTGTGGTTGTTTTTTCTGT TTACGTAACCTGCTTAGT CTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGCGGCAACAGTG ... lymphocyte transformation and oncogenesis As noted in studies of tumors and cell lines, expression of latent EBV genes contributes to cell transformation, and these studies have resulted in the description...
- 15
- 426
- 0
Báo cáo y học: "Patients with systemic lupus erythematosus have abnormally elevated Epstein–Barr virus load in blood" pps
... determine bivariate correlations Results Epstein Barr virus detection and Epstein Barr virus typing in mouthwash samples To detect EBV infection and to determine the type of infecting EBV, DNA ... SLE SLE Type (c) Type Type systemic lupus erythematosus (SLE) in mouthwash samples Epstein Barr virus (EBV) typing of normal individuals and patients with systemic lupus erythematosus (SLE) in ... detected in the blood sample was identical to that in the mouthwash sample (data not shown) Discussion The present study was undertaken to examine the types of EBV infecting SLE patients and their...
- 8
- 251
- 0
Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx
... of the cases diagnosed were at advanced stage of the disease [4] A unique feature of NPC is its strong association with Epstein- Barr virus (EBV) EBV DNA is consistently detected in patients with ... reported in Southern China This was first described in the CAO strain, the nude mouse passaged Chinese NPC EBV isolate The presence of Xho-I loss variant in our tissues samples is comparable to other ... variants with 30-bp deletion and/ or loss of XhoI restriction site as well as the co-existence of these variants in NPC tissues and plasma with population characteristics and histological type Methods...
- 10
- 356
- 1
Báo cáo y học: "Primary effusion lymphoma associated with Human Herpes Virus-8 and Epstein Barr virus in an HIV-infected woman from Kampala, Uganda: a case repor" pptx
... definition, has to be present in the tumor cells in order to make a diagnosis of PEL [15] The co-infection of HHV-8 and EBV in this patient is interesting Both HHV-8 and EBV are g-herpes viruses and ... Discussion We have reported the case of a patient who presented with all the features of PEL that have been described elsewhere [14,15] This was the first AIDS defining illness in this patient ... discharged through the Infectious Disease Institute clinic to be initiated on HAART She was due to return for subsequent anti-cancer treatment but died two days after discharge from our hospital...
- 5
- 394
- 0
Báo cáo y học: "The inverse association of serum HBV DNA level with HDL and adiponectin in chronic hepatitis B infection" ppt
... well understood To further investigate association of HDL and adiponectin with HBV replication rate and therefore introducing a possible strategy for treating patients with chronic hepatitis B, we ... according to the manufacturer s instructions The linear range of this assay was 102-109 copies/ml Statistical Analysis Results were expressed as mean ± standard deviation Relations between continuous ... differences were tested by Student s t- test To find nonlinear association between HBV DNA and HDL with adiponectin in scatter plots, Epanechnikov kernel smooting was used Analyses were done using STATA...
- 6
- 320
- 0
Báo cáo y học: " Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1)" pot
... closest TSS regardless whether the peak is residing upstream or downstream to the TSS Figure 3A shows the distribution of ChIP-seq peaks relative to the TSSs We then selected a subset of ChIP-seq ... considered a potential driving force for the Burkitt s translocations, and it is possible that these EBNA1 binding sites may link these sites to facilitate translocation Discussion EBNA1 can interact ... A: The amino terminus of Epstein- Barr Virus (EBV) nuclear antigen contains AT hooks that facilitate the replication and partitioning of latent EBV genomes by tethering them to cellular chromosomes...
- 17
- 445
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25