structuring population based ecological risk assessments in a dynamic landscape
Coastal and Estuarine Risk Assessment - Chapter 11 ppt
... local environment as adequate foraging habitat The great blue heron is a wading bird that can utilize a variety of freshwater and marine habitats It is found in areas of shallow water that have ... than m Habitat quality was also assumed to be proportional to relative habitat density Habitat within urban areas was deemed unsuitable Prey availability was determined from available state surveys ... overall advantage that a heron would derive by foraging at that location Habitat quality is a site-specific parameter and dependent upon estimates of the quantity of available forage fish and the quality...
- 24
- 295
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
... demographic data Mean age was 68 years old (quartile range: 59-77) The major ethnicities were European American (44%), African American (37%) and Hispanic American (11%) Table Demographics Characteristics, ... specificity may not be high The OAB-V8 questionnaire has only been validated in a primary care setting Validation in a high risk population is still pending Our study showed that among those with OAB, ... Herschorn S, Gajewski J, Schulz J and Corcos J A population- based study of urinary symptoms and incontinence: the Canadian Urinary Bladder Survey BJU Int 2008; 101:52 Milsom I, Abrams P, Cardozo L,...
- 4
- 520
- 0
Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx
... known as methylene chloride, is mainly used as a paint remover but is also applied as a solvent and cleaning agent in a variety of industries The few epidemiological studies investigating occupational ... http://www.occup-med.com/content/2/1/2 Table 2: Exposure to chlorinated and aromatic hydrocarbons and lymphoma in total (n = 710 matched pairs) Cases Adj ORa Controls 95% CI N CHLORINATED HYDROCARBONS Chlorinated hydrocarbons in ... repeated Among population controls the participation rate was 44.3% A total of 710 case-control pairs were included in the analysis Data collection Intensively trained interviewers elicited detailed...
- 11
- 456
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... Tornero-Molina J, Naranjo A, Alperi-Lúpez M, Erra A, Pascual-Salcedo D, Barcelú P, Camps J, Marsal S: Genome-wide association study of rheumatoid arthritis in the Spanish population: KLF12 as a risk...
- 11
- 460
- 0
Risk management in a car factoryQuản lý trong công ty sản xuất xe hơi
... Cash Provided by Operating Activities Net Cash Outflows from Investing and Financing Activities 33,403,706 • Increase in sales returns and allowances: The sales returns and allowances increased ... 7% Capital Stock Total Shareholders' Equity 1.1 Variance Analysis for Deviation over 20% • The increase in current assets was largely due to an increase in cash and cash equivalents, which in ... other internal or external factors has changed or expects to have any significant change, explain the fact, influencing factors and the possible impact to the Company's future finance and responding...
- 4
- 296
- 0
Báo cáo y học: "Low back pain risk factors in a large rural Australian Aboriginal community. An opportunity for managing co-morbiditie" ppt
... Victoria, Australia) [28] to validate the findings reported in the screening questionnaire A positive pain finding in the clinical assessment was derived by practitioner -based examination, including ... Dejima M, Miyakita T, Kodera R, Hamada H, Nakagiri S, Aoyama H: An epidemiological study on low back pain and occupational risk factors among clinical nurses Sangyo Igaku 1991, 33(5):410-22 [Article ... back pain in Australian aboriginals Spine 1996, 21(7):841-3 Vindigni D, Griffen D, Parkinson J, Da Costa C, Parkinson L: The prevalence of musculo-skeletal conditions, associated pain and disability...
- 12
- 264
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... III Dynamic models contain incomplete information, and the sets, relations, and functions in these models can be incompletely specified (their domains are usually incomplete) In PTQ, some phrases ... h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows two ~-expressions that initially have ... intensionally-equivalent formulas are not identified as being equivalent, the mechanism "thinks" that it is possible to expand their domain to include a distinguishing element Since the formulas are equivalent...
- 3
- 394
- 0
Corporate Taxation in a Dynamic World pot
... focused on tax avoiding practices He maintained that setting up new rms can avoid taxation by reclassifying their earnings as corporate rather than personal income, as long as the former is taxed less ... under risk aversion, a higher marginal tax rate may reduce the propensity to undertake a self-employed activity On the other hand, the higher marginal tax rate might also act as an insurance against ... project.7 In two interesting papers, Alvarez and Kanniainen (1997, 1998) analyzed the Johansson-Samuelson Theorem8 in a real-option setting They showed that as long as taxation leaves the projects value...
- 235
- 414
- 0
Affordable-Accessible Housing In A Dynamic City potx
... For example, aging population, rising fuel prices, increasing traffic congestion, and improved urban livability are all increasing demand for urban housing and business location A rational real ... building maintenance and infrastructure investment, and increased sprawl Many factors that contributed to urban decline are now reversing Current trends are increasing demand for affordable-accessible ... by a parking facility 5-15% Increase capacity of existing facilities Increase parking supply by using otherwise wasted space, smaller stalls, car stackers and valet parking 5-15% Mobility management...
- 52
- 278
- 0
stork - living in a dynamic tropical forest landscape (blackwell, 2008)
... Austrobaileyaceae, Eupomatiaceae, Himantandraceae, Myristicaceae and Winteraceae of the order Magnoliales; Atherospermataceae, Gyrocarpaceae, Hernandiaceae, Idiospermaceae, Lauraceae and Monimiaceae of ... National Park Guatemala 57 600 Sinharaja Forest Reserve Sri Lanka 864 Montane rainforest Venezuela Talamanca/Amistad Costa Rica/Panama 791 592 Sangay National Park Equador 271 925 Machu Picchu Peru ... et al (2001) have shown that these upland forests are particularly sensitive to changes in temperature and rainfall Changes as small as a 1°C increase in temperature and a 10% decline in rainfall...
- 663
- 421
- 0
Báo cáo hóa học: " Steinfield, H., Mooney, H.A., Schneider, F. and Neville, L. E. Livestock in a changing landscape: Drivers" pptx
... as milk and eggs, is far larger in the rural areas than in the urban areas General increases in production over the years, particularly with regard to poultry, are highlighted The Indian data ... production takes place The shrinking communal resource base has forced a shift in animal farming in favour of small ruminants The limited grazing areas are placed under greater pressure as extensive ... management Regulatory systems with a regional approach, including utilization of animal wastes and increased storage time, are advocated The policy regarding nutrient loads is aimed at increasing the...
- 7
- 241
- 0
Báo cáo hóa học: " Research Article Prerouted FPGA Cores for Rapid System Construction in a Dynamic Reconfigurable System" pot
... policy layer provides a mechanism to share border crossing wires to maintain a good internal wire bandwidth WIN and an appropriate interface bandwidth WIF to the interface layer as shown in Figure ... direction An interface instance assigned to a particular border edge location is a port An assigned interface is created by optimizing the signal ordering and mapping them to the wires made available ... (BLC), a set of interface signals, and a set of interface definitions The interface definitions are described in XML and provide an absolute wire assignment for each signal in an interface Mapping an...
- 7
- 307
- 0
A behaviour based algorithm for encirclement of a dynamic target using multiple mobile robots
... motor-schema behaviour -based system with other navigational behaviours so that a robotic team can reach navigational goal, avoid hazards and simultaneously maintain in their intended formation The ... Each behaviour can contribute in varying degrees to the robot’s overall response by setting different gain In [8], Balch and Arkin have shown that formation behaviour can be integrated into a ... is a common phenomenon in nature, e.g wolves hunt in a pack to increase their success in capturing prey Animals can benefit from coordinated movement by combining individual sensing ability In...
- 132
- 256
- 0
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... design and a routine control selection design in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991 As an example, we assessed the hazards ... given indication Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers The possible explanations may be: ... groups in a population- based case-control study, to assess the association between smoking and death from various cancers in Chinese men It shows that tobacco smoking is associated with a moderate,...
- 9
- 532
- 1
Báo cáo y học: "Increased risk of peripheral arterial disease in polymyalgia rheumatica: a population-based cohort study" ppsx
... No Warrington et al Table Risk of developing peripheral arterial disease in polymyalgia rheumatica and non-polymyalgia rheumatica Model adjustors Hazard ratio (95% confidence interval) Age and ... levels are associated with greater functional impairment in patients with PAD [21] In the general population, patients who have PAD and increased inflammation are at high risk for adverse cardiovascular ... This linked medical-records system allows access to accurate and detailed clinical and laboratory data over many years, which are not typically available in other databases or research settings...
- 6
- 378
- 0
Vacuum assisted birth and risk for cerebral complications in term newborn infants a population based cohort study
... other maternal and infant risk factors – to neonatal brain injury Methods This study was based on information in two national databases held by the Swedish National Board of Health and Welfare, and ... non-traumatic intracranial hemorrhages, whereas infants delivered by CS had no increased risk for either traumatic or non-traumatic intracranial hemorrhages Maternal characteristics, parity, GA, and ... diagnostic accuracy of neonatal brain damage MRI in a small clinical series of asymptomatic newborn infants has revealed a high prevalence and high spontaneous resolution of small intracranial hemorrhages...
- 10
- 391
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... Acute vital (life threatening) danger NACA Acute cardiac or respiratory arrest NACA Death NACA score as a routine for their patients The patient’s status is classified from to 7, zero indicating no ... Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund We want to thank ... one was dead The 256 extra patients, all interrupted missions, allocations of ambulances, and support to Zakariassen et al Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine...
- 9
- 784
- 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
... estado de São Paulo, Brasil: estudio poblacional Palabras clave 27 Organização Pan-Americana da Saúde Saúde nas Américas: 2007 Washington, D.C.: OPAS; 2007 (Scientific Publication No 662) 28 Wang ... significantly affects bodily pain was noteworthy as well (difference of –18.6 points in the mean score) The same finding was reported by Goldney et al in a population- based study in Australia that ... functioning scales Depression/ anxiety made a considerable impact as well, with large differences in mean score, particularly affecting mental health and role-emotional Arthritis and backpain had...
- 8
- 701
- 0
Cancer survival in five continents: a worldwide population-based study (CONCORD) ppt
... 127 Sankaranarayanan R, Black RJ, Swaminathan R, Parkin DM An overview of cancer survival in developing countries In: Sankaranarayanan R, Black RJ, Parkin DM, eds Cancer survival in developing ... Fernandez Garrote L, Graupera Boschmonar M, Galan Alvarez Y, Lezcano Cicilli M, Martin Garcia A, Camacho Rodriguez R Cancer survival in Cuba In: Sankaranarayanan R, Black RJ, Parkin DM, eds Cancer ... Cuba† France USA Canada Australia Japan Sweden Malta Norway Netherlands Austria Germany Spain Iceland Finland Italy Ireland Northern Ireland Denmark Scotland England Portugal Brazil Wales Slovakia...
- 27
- 365
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25