structure and function of a dogs eye
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
Ngày tải lên :
07/03/2014, 00:20
... shared secondary structure characteristics of transthyretins and TLPs are indi-
cated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated ... 0
Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0
Roseovarius sp. HTCC2601 Proteobacteria, Alphaproteobacteria 2 0
Ralstonia eutropha H16 Proteobacteria, Betaproteobacteria ... colonize
various animals. Uric acid is secreted on the surface of
mucosal epithelial tissues of all animals as part of the
innate immune system [47] and is also thought to act
as a microbicidal agent...
- 13
- 390
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
Ngày tải lên :
19/02/2014, 12:20
... to pain and was effective in
alleviating chronic pain and accelerating functional recovery
in an animal model of neuropathy. These data are in
agreement with an important role of nAChRs in pain
perception, ... interfaces within neuronal nAChR subunit
combinations (compare Fig. 2A C)
4
.Sofar ,a- conotoxins
selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2
(a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) ... investigation
and understanding of their structure- activity relationships,
may start to provide a rational way to develop additional
pharmacological tools for the elucidation of nAChR
structure and function.
Ó...
- 15
- 757
- 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
Ngày tải lên :
16/03/2014, 16:20
... Zeta, Phi, Tau
and O mega [3,4,9]. Whereas Zeta, Theta and Omega classes
of GSTs are found in plants and animals, the large Phi and
Tau classes a re unique to plants [9]. In maize ( Zea m ays L),
42 ... fractional residual activity of the
partial active enzyme intermediate, and k
fast
and k
slow
are
the rate constants for the slow a nd fast phase of the reaction.
Analysis was performed using the
GRAFIT
(Erithacus
Software ... probing the structure and function of glutathione transferases
Georgia A. Kotzia and Nikolaos E. Labrou
Laboratory of Enzyme Technology, Department of Agricultural Biotechnology, Agricultural University...
- 9
- 556
- 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
Ngày tải lên :
14/02/2014, 18:20
... complex
than in T cells, with several peaks of nuclease hyper-
sensitivity [85]. Mast cells express GATA-2 as well as
NFAT and AP-1, and GATA-2 initiates the formation
of an additional discrete GATA-2 ... typically recruit
HATs such as SAGA and NuA3, which mainly acety-
late histone H3, and NuA4 which acetylates histone H4
on K5, K8 and K12. This cascade of events leads to
recruitment of transcription ... H4-K16,
the NuA4 group of HATs are essential for H4-K5, K8
and K12 acetylation [136–138]. In yeast, this group is
made up of NuA4 and Piccolo NuA4 which both uti-
lize Esa1 as the HAT, and Esa1 was found...
- 29
- 743
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
Ngày tải lên :
14/02/2014, 19:20
... Science Institute, Saitama, Japan
2 JST, CREST, Kawaguchi, Saitama, Japan
3 Research Institute of Pharmaceutical Sciences, Musashino University, Tokyo, Japan
4 Faculty of Science and Technology, ... co-
immunoprecipitation.
Primary cultures, transfection and imaging of
hippocampal and cerebellar neurons
Hippocampal and cerebellar dissociated primary cultures
were prepared from ICR mice (Nippon SLC, Hamamatsu,
J. ... circuits, and also may provide a clue to the
understanding of some MAP2-associated neurodegen-
erative and psychiatric disorders [16,17].
Materials and methods
Animals
Mice (ICR) were purchased from...
- 11
- 658
- 0
Tài liệu Body Size: The Structure and Function of Aquatic Ecosystems pptx
Ngày tải lên :
17/02/2014, 19:20
... spp.
1
Stylatula elongata
1
Xenia spp.
1
Actinaria (sea anemones) Anemonia viridis
1
Anthopleura elegantissima
Corynactis californica
1
Metridium senile
Zoanthidea Palythoa variabilis
Scleractinia (hard ... Lepas pectinata
Copepoda Centropages typicus
Stylasterina (Hydrozoan hard corals) Stylaster californicus
1
Octocorallia (soft corals & sea pens) Paracyanthus stearnsi
1
Sansibia spp.
1
Stylatula ... Data on r
max
for a
wide variety of organisms, from unicellular eukaryotes to invertebrates and
vertebrates, have been compiled and analyzed by Savage et al.(2004b). These
data give a slope of...
- 357
- 2K
- 0
Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx
Ngày tải lên :
19/02/2014, 12:20
... relationship and tertiary
structure. Plant APs have been distributed among families
A1 , A3 , A1 1 and A1 2 of clan AA, and family A2 2 of clan
AD. The majority of plant APs belongs to the A1 family,
together ... Molecular and biochemical characterisation of two aspartic
proteinases TcAP1 and TcAP2 from Theobroma cacao seeds.
Planta 215, 754–762.
12. Park, H., Yamanaka, N., Mikkonen, A. , Kusakabe, I. &
Kobayashi, ... phytepsin was purified from barley (H. vulgare)(acces-
sion number: X56136); AtAsp1, AtAsp2 and AtAsp3 are A. thaliana
aspartic proteinases (accession numbers: U51036, AY070453 and
AF076243, respectively);...
- 9
- 605
- 0
Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf
Ngày tải lên :
19/02/2014, 16:20
... the structure and dynamics
of each protein, and present a comparison of s bwAFP and
TmAFPwitheachotherandwithproteinsthathavea
similar fold.
Structure of sbwAFP and TmAFP
The structure of sbwAFP ... growth.
Conclusion
Analysis of the structure and examination of the i ce-binding
behaviour and point mutants of s bwAFP and TmAFP
provides an explanation for their hyperactivity compared to
the previously characterized ... the case of one sbwAFP isoform,
named CfAFP-501, a detailed e xamination of t he structure
and function was undertaken [57]. An overall match of 66%
amino-acid identity was observed, with an insert...
- 12
- 716
- 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
Ngày tải lên :
06/03/2014, 11:20
... 389–392; and b7, 409–412) form a
b-sheet with three antiparallel strands (1, 2 and 7) and
strand 6, which is parallel to strand 2. b-Strands are
located between the four a- helices (a1 , 278–294; a2 ,
305–313; ... signal
of the preceding amino acid, correlating the amide HN and
the Ca signals, correlating the amide HN and the Ca signal
of the preceding amino acid, correlating the amide NH with
the Ca and ... protein backbone, and for
more than 78% of the side chain atoms.
The main set of backbone u and w dihedral angles was
calculated from the chemical shift values of backbone
atoms
13
Ca,
13
Cb,
13
C¢,
1
Ha,
1
HN,...
- 17
- 490
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
Ngày tải lên :
06/03/2014, 22:21
... The Authors Journal compilation ª 2010 FEBS
Staphylococcus aureus elongation factor G – structure and
analysis of a target for fusidic acid
Yang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria ... Helgstrand M, Mandava CS, Mulder FA, Liljas A,
Sanyal S & Akke M (2007) The ribosomal stalk binds
to translation factors IF2, EF-Tu, EF-G and RF3 via a
conserved region of the L12 C-terminal ... 4714177
E-mail: maria.selmer@icm.uu.se
Database
The atomic coordinates and observed
structure factors are available in the Protein
Data Bank database under the accession
number 2XEX
(Received 22 April...
- 15
- 474
- 0
Báo cáo khoa học: Structure and function of KH domains docx
Ngày tải lên :
07/03/2014, 05:20
... b1-strand and b2-strand are adjacent
and parallel to each other, and the b¢-strand is adja-
cent and antiparallel to the b1-strand (Fig. 1). The
length and sequence of the variable loop are different
in ... RNA. The tandem KH1–KH2 domains of NusA recognize
RNA ligand 5¢-GAACUCAAUAG. (A) The KH1–KH2 domains of NusA bound to cognate RNA ligand (Protein Data Bank entry 2ASB). The
RNA–protein contact ... order
b1, b¢ and b2. The b1-strand and b2-strand are parallel
to each other, and the b¢-strand is antiparallel to both
(Fig. 1). This all-antiparallel arrangement of strands
distinguishes the type...
- 15
- 405
- 0
Báo cáo khoa học: Structure and function of N-acetylglucosamine kinase Identification of two active site cysteines pptx
Ngày tải lên :
08/03/2014, 10:20
... 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC
TGATGG
C143S 5¢-GATGGCTCCGAGAGTGGCAGTGGAGGCTGGGG
C211S 5¢-CCCATTTGTATAGGGACTTTGATAAAAGTAAG
TTTGCTGGATTTTGCCAGAAAATTGC
C217S 5¢-GCTGGATTTAGTCAGAAAATTGCAGAAGGTG
CACATCAGGG
C268S ... presumably with different regulation.
GlcNAc kinase has been cloned from man [8] and mouse
[9]. Like N-acetylgalactosamine kinase [10] and N-acetyl-
mannosamine kinase, as a part of the bifunctional ... generation of GlcNAc kinase
cysteine mutants by site-directed mutagenesis. Mismatches with the
template are underlined.
Name Sequence
C45S 5¢-
GGCACAGACCAGAGTGTGGAGAGGATCA ATGAG
C131S 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC
TGATGG
C143S...
- 7
- 421
- 0
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
Ngày tải lên :
21/02/2014, 15:20
... cal-
orimetry, of bovine b-andj-casein, recombinant human a- ,
b-andc-synuclein, together with the A3 0P and A5 3T mu-
tants of a- synuclein associated with familial cases of Par-
kinson's disease, and ... the A3 0P and A5 3T mutants of
a- synuclein that cause f amilial c ases of Parkinson's disease.
Unfortunately the quality of s ome of these syn uclein ROA
spectra i s generally not as good as ... temperature backscattered
Raman a nd ROA spectra of bovine b-casein (top pair) and
j-casein (bottom p air) at pH 7.0. Overall, the ROA spectra
are very much a like, demonstrating that the basic...
- 9
- 667
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
Ngày tải lên :
06/03/2014, 09:22
... Ile-Glu-Ala-Arg-p-nitro-
anilide (IEARpNA) [31]. ProHP8
Xa
lacked IEARase
activity, but after the zymogen was activated by factor
Xa, IEARase activity increased significantly above that
of factor Xa alone, which could also ... the
substrate (Fig. 6B). These results indicated that factor
Xa cleaved and activated proHP8
Xa
.
When activated HP8
Xa
was mixed with proSpa
¨
tzle-
1A, the 38 kDa pro-Spa
¨
tzle band disappeared, and ... (2004)
Beta-1,3-glucan recognition protein-2 (betaGRP-2)from
Manduca sexta; an acute-phase protein that binds
beta-1,3-glucan and lipoteichoic acid to aggregate fungi
and bacteria and stimulate prophenoloxidase...
- 15
- 540
- 0
Báo cáo Y học: Structure, mechanism and function of prenyltransferases docx
Ngày tải lên :
08/03/2014, 22:20
... &
Glomset, J .A. (1994) Rab geranylgeranyl transferase catalyzes
the geranylgeranylation of adjacent cysteines in the samll
GTPases Rab 1A, Rab 3A, and Rab 5A. Proc. Natl. Acad. Sci.
USA 91, 11963–11967.
89. ... FTase in
complex with FPP [38] as well as the structure of the ternary
complex containing an inactive FPP analogue and a CaaX
peptide substrate [39]. Many features of the apo-FTase
structure are ... Synthesis and
characterization of aza analog inhibitors of squalene and
geranylgeranyl diphosphate synthases. J. Org. Chem. 57, 3444–
3449.
75. Sagami, H., Korenaga, T., Ogura, K., Steiger, A. , Pyun,...
- 16
- 528
- 0
- natural mould and soil of a garden
- english language structure and use of english
- name and function of each part
- the structure and functions of the red cell membrane macromolecules that carry them
- enzyme structure and function
- the life and death of a rogue ap
- the history structure and themes of the quran
- the structure and processes of the earth
- the structure and process of planning
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2