natural mould and soil of a garden

Genetic origin and composition of a natural hybrid poplar Populus × jrtyschensis from two distantly related species

Genetic origin and composition of a natural hybrid poplar Populus × jrtyschensis from two distantly related species

... Wang H, Graham JH, Freeman DC Nine‐year reciprocal transplant experiment in the gardens of the basin and mountain big sagebrush (Artemisia tridentata: Asteraceae) hybrid zone of Salt Creek Canyon: ... applicable Availability of data and materials The datasets supporting the conclusions of this article are included within the article and its additional files The nuclear genes sequences datasets ... nigra and P laurifolia at numerous locations in western China Populus nigra, the black poplar of sect Aigeiros, is mainly found in Europe and has limited ranges in central Asia and northwest Africa

Ngày tải lên: 22/05/2020, 04:18

12 8 0
Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

... the peak rate of heat release is at 357 degree crank angle and on retarding by 3 and 6 degrees, the peak heat release rate is found at 362 and 363 degrees against 361 degree with standard timing. ... 343-350. [10] D. Agarwal and A. K. Agarwal. Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine. Applied Thermal Eng 27 ... Mechanical Engineering Department, College of Technology & Engineering, Maharana Pratap University of Agriculture and Technology, Udaipur -313001, India. Abstract The present study aims at evaluation

Ngày tải lên: 05/09/2013, 16:11

10 829 1
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with use of

Ngày tải lên: 05/09/2013, 16:30

14 594 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... me, as a teacher of English, functional grammar is a really interesting and useful branch of linguistics It provides me with an analytic tool of looking at the whole text and the grammatical features ... using Halliday’s functional grammar as a theoretical framework Hopefully, this study makes a certain contribution to the teaching and learning English as a foreign language in Vietnam 1.2 Aims of

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to )23, AAANNN TTATATA) ... with g values at 2.031, 1.994, and 1.951. The resonance started to develop at potentials ‡ 0 mV and was stable at potentials up to +350 mV. The loss and formation of the resonance was associated

Ngày tải lên: 21/02/2014, 03:20

10 564 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid Yang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria Selmer Department of Cell and Molecular ... 4714177 E-mail: maria.selmer@icm.uu.se Database The atomic coordinates and observed structure factors are available in the Protein Data Bank database under the accession number 2XEX (Received 22 April 2010, ... linker has flipped away to create the 40 A ˚ shift of domain IV relative to domain III Mutation to a larger side chain may change the relative positions of domain III and V [16] as well as the

Ngày tải lên: 06/03/2014, 22:21

15 475 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... Proteobacteria, Gammaproteobacteria 1 1 Salmonella enterica ssp. I choloraesuis Proteobacteria, Gammaproteobacteria 0 2 Chromohalobacter salexigens DSM3034 Proteobacteria, Gammaproteobacteria 1 1 Acinetobacter ... Proteobacteria, Alphaproteobacteria 2 0 Dinoroseobacter shibae DFL 12 Proteobacteria, Alphaproteobacteria 2 0 Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0 Roseovarius ... shared secondary structure characteristics of transthyretins and TLPs are indi- cated above the alignment: motifs A? ??–C’ are indicated with straight lines and are labelled; b-strands are indicated

Ngày tải lên: 07/03/2014, 00:20

13 390 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic ... amount of Bip-Pro in the extracellular uptake medium was quantified according to the laboratory standard HPLC (La-Chrom Ò ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and a ... Gly-Gln, Ala- Ala, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, Germany). Tert. butyloxycar- bonyl (Boc)–Bip,

Ngày tải lên: 07/03/2014, 05:20

10 490 0
PROCEDURES ON IMPORTATION AND REGISTRATION OF A CAR IN SINGAPORE doc

PROCEDURES ON IMPORTATION AND REGISTRATION OF A CAR IN SINGAPORE doc

... Japan) and was manufactured to Japanese Safety Standard for domestic use in Japan; The original... LTA as Temporary Certificate of Entitlement, TCOE) Original identification document of ... profile printout of the Club/Association/Organisation or other certificate issued by the relevant regulating authority and original NRIC (Singaporean, Singapore PR and Malaysian) or Passport ... emission standard and above (for diesel-driven car); or c) Get your car tested and certified by any of LTA/NEA-recognised vehicle test laboratories (listed in Annex A) . The laboratories are required

Ngày tải lên: 07/03/2014, 11:20

23 533 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢ ... 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime ... procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesocricetus auratus) Cercariae were released from infec- FEBS Journal 274

Ngày tải lên: 07/03/2014, 11:20

16 543 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P. furiosus CoADR. The ... act as an NADH oxidase in vivo, instead act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a ... concentration (as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and bacterial NADH oxidases

Ngày tải lên: 07/03/2014, 17:20

12 420 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... Phytophthora megasperma. This enzy- matic activity plays a fundamental role in the biosynthesis of methylated dianthramide-derivatives, the carnation phyto- alexins. However, no data are available regarding ... several plants, an accumulation of methylated flavonoids has been explained as a protection against pathogens, predators and ultraviolet radiation [2]. A recent investigation concerning the pathogenic ... compo- nents of each reaction mixture, after their chromatographic separation and purification, were submitted to 1 HNMR (nuclear magnetic resonance) and FABMS (fast atom bombardment mass spectrum) analyses

Ngày tải lên: 08/03/2014, 08:20

10 624 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... bridge. Structural and functional characteristics of Ch-PRX1 The amino-acid sequence of Ch-Prx1 shares highest identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and ... were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2). Computer database searches based on the amino-acid sequences ... P., Rivera-Madrid, R., Marinho, P., Le Mare  chal, P., Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase: cDNA characterization and expression of the

Ngày tải lên: 08/03/2014, 16:20

11 608 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and purification of L-amino acid acylase ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an

Ngày tải lên: 08/03/2014, 16:20

11 657 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGG ARA439 GGAATTC CATATGCGTATTATGGCCAG ARA440 TATTTA CTCGAGAATCCCCTCCTCAGC ARA444 CG GGATCCACCGTGAAAAAGAAAGAATTGTC ARA451 GAATTCATAAAG AAGCTTTGTCTGAAGC ARA456 CGGCGCGT CATATGGCCAGTCATGATA ARA457 ... CGGCGCGT CATATGGCCAGTCATGATA ARA457 TGATACG CATATGTCACCGGCTGGC ARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAG ARA460 CGT GAATTCACCGAGCATGTCACCAAAGCC ARA477 ... CGT GAATTCACCGAGCATGTCACCAAAGCC ARA477 AATCAGAATG GGATCCGGTGA ARA486 CGGCTG ACATTCTGATTGACTTGGACGG ARA487 CAATCAGAATGTC AGCCGGTGACACAGG ARA509 CC AGT CAT GAT A AG CCT GTG TCA CCG ARA510 CGG TGA CAC AGG C TT ATC ATG

Ngày tải lên: 14/03/2014, 23:20

14 594 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... GAATTCTCAGCCTGATATTTCCGCCT (EcoRI) CGTGCTCGTAAACGATGCGTATTAC ACAATCTCTTTGCCGGCCTCCGC GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen ... purified AATB3 Values for Km and Vmax for both amino donors (l-aspartate and l-glutamate) and acceptors (a- ketoglutarate and oxaloacetate) were calculated from the double-reciprocal plots The Km values ... 30 mM L-aspartate was used as amino donor for a- ketoglutarate, and 30 mM L-glutamate was used as amino donor for oxaloacetate The activity of a- ketoglutarate was adjusted to 100 L-aspartate Fig

Ngày tải lên: 14/03/2014, 23:20

13 490 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... The bandwidth of each of the five phases is shown separately. Sprite LFS has a higher write bandwidth and the same read bandwidth as SunOS with the exception of sequen- tial reading of a file that ... log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data area is ... in part by the National Aeronautics and Space Administration and the Defense Advanced Research Projects Agency under contract NAG2-591. This paper will appear in the Proceedings of the 13th ACM...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
Design and Implementation of a Three-Phase Induction Motor Control Scheme

Design and Implementation of a Three-Phase Induction Motor Control Scheme

... advantages are clearly explained. Wildi also presents the two types of induction motors: “the squirrel cage induction motor” and the “wound motor”. An explanation of the advantages and disadvantages ... induction machine is an electrical device. The electrical properties that are of particular interest to this thesis project are the stator and rotor’s resistance and inductance, as well as the magnetizing ... that is written by Mr. Marshall Brain. It provides a basic introduction onto how a hybrid car works. Within this article, the definition of the hybrid car and its potential advantages are stated....

Ngày tải lên: 27/10/2013, 23:15

93 695 1
Design and Simulation of A CMOS-MEMS Accelerometer

Design and Simulation of A CMOS-MEMS Accelerometer

... major parameters of the device. Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF. ... of 60fF. Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4. The capac- itance ratios are derived from the ratios of driving signals and buffer ... C f1 and C f2 are reset to zero charge, and hold capacitors C h ’s are floating. During the Integrate 1 phase, the difference of charges on C i1 and C i2 are inte- grated to C f1 and C f2 , and...

Ngày tải lên: 27/10/2013, 23:15

40 589 1

Bạn có muốn tìm thêm với từ khóa:

w