stress meiosis and nutrient limitation genes are associated with antisense transcripts at mid log phase
Báo cáo y học: " Strand-specific RNA sequencing reveals extensive regulated long antisense transcripts that are conserved across yeast specie" ppt
... change mid- log to late stationary phase (log ratio) M RK1 MRK1 -1.5 change mid- log to heat shock (log ratio) Heat shock 1.5 -1.5 change mid- log to salt shock (log ratio) 1.5 C RF1 CRF1 Late stationary ... runthrough transcription Stress, meiosis and nutrient limitation genes are associated with antisense transcripts at mid- log phase To explore the potential function of the antisense units, we examined ... containing the NatMX4 cassette using the following primers: GTAAAAGTATTTGGCTTCATTAG TGTGTGAAAAATAAAGAAAATAGATACAATACTATCGACGGTCGACGGATCCCCGGGTT and AAGA AAGTATATAAAATCTCTCTATATTATACAGGCTACTTCTTTTAGGAAACGTCACATCGATGAATTCGAGCTCGTT...
- 14
- 339
- 0
báo cáo hóa học:" Nutrition and inflammation serum biomarkers are associated with 12-week mortality among malnourished adults initiating antiretroviral therapy in Zambia" potx
... could be related to infection with HIV-1 subtype C compared with other viral subtypes [26] Elevated CRP and other inflammation biomarkers are associated with endothelial dysfunction and an increased ... International AIDS Society 2011, 14:19 http://www.jiasociety.org/content/14/1/19 We previously demonstrated that serum phosphate levels at ART initiation are independently and negatively associated ... cardiovascular, respiratory and neurologic sequelae, and death [14,15,29] The current finding that interval increases in phosphate from treatment initiation to 12 weeks were not associated with reduced subsequent...
- 8
- 297
- 0
Báo cáo y học: "erum levels of soluble receptor for advanced glycation end products and of S100 proteins are associated with inflammatory, autoantibody, and classical risk markers of joint and vascular damage in rheumatoid arthritis" doc
... proinflammatory and/ or pro-atherogenic RAGE ligand binding Factors associated with serum levels of sRAGE in patients with established RA Simple linear regression analysis showed that serum sRAGE ... associations of sRAGE and S100 proteins with clinical inflammatory factors, complications, and CV risk factors in established RA patients S100 A8, A9 and A12 were all elevated in serum from patients ... http://arthritis-research.com/content/11/2/R39 Our analysis indicates that sRAGE and S100 proteins are associated not only with RA inflammation and autoantibody production, but also with the recruitment of classical vascular...
- 11
- 420
- 0
Báo cáo sinh học: "Changes in muscle cell cation regulation and meat quality traits are associated with genetic selection for high body weight and meat yield in broiler chickens" ppt
... weight and CK in the full data set that are weak and non-significant in the traditional and layer lines There are also several strong correlations between thigh and breast colour, pHi, pHu, pH and ... force that are not present among L and T lines These data suggest that there is no relationship between pH and toughness in the lines that have not been selected for broiler traits compared with ... force and plasma ion concentrations in L and T lines whereas the relationships were negative and significant for Na+, total and free Ca++ High plasma ion concentrations were negatively and positively...
- 8
- 306
- 0
SPECIAL REPORT: National Survey of Children’s Health Finds Intact Family and Religious Participation Are Associated with Fewer Developmental Problems in School-Age Children pdf
... the association with religious attendance is about equal to that with family integrity An intact two-parent family and regular religious participation are also associated with the parent reporting ... parent education levels, and race and ethnicity An intact two-parent family and regular church attendance are each associated with fewer problem behaviors, more positive social development, and ... foster parents or other relatives Still another 13 percent live with both parents but attend religious services infrequently or not at all And 12 percent are not living with both parents AND not attending...
- 36
- 343
- 0
báo cáo hóa học: " Indoors illumination and seasonal changes in mood and behavior are associated with the health-related quality of life" pdf
... associations of HRQoL with exposure to illumination and with seasonal changes in mood and behavior To be specific, we aimed at elucidation of associations, if any, of the 15D Health-Related Quality ... physiological pathway from the habitat to the health status and HRQoL, barriers to the physical and social activities are likely to have an impact on an individual basis Strengths and limitations ... education in three categories (low, middle or high), marital status in two categories (living alone or with someone), area of living in two categories (the southern or northern part of Finland),...
- 8
- 469
- 0
báo cáo hóa học: " Distress and quality of life characteristics associated with seeking surgical treatment for stress urinary incontinence" pptx
... episodes and total UDI and IIQ scores [55] Relationships between UDI and IIQ were examined at baseline and post-operatively One study reported a moderate correlation between UDI and IIQ at baseline ... related study using the same population of patients examined the relationship between clinical and demographic factors associated with IIQ scores [57] They found that lower IIQ scores are associated ... demonstrate that greater urine leakage and episodes of incontinence were significantly associated with increased UDI and IIQ scores [55] Examining symptoms remaining after surgery and UDI and IIQ...
- 8
- 451
- 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... sequence http://www.virologyj.com/content/2/1/24 TTTAGTTAAGGCAAATAATA 3’ TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, ... amplification (30 sec at 94°C, 30 sec at 50°C, at 72°C), and a final extension of at 72°C in a thermal cycler (Eppendorf, Hamburg, AG) PCR products were run on a 2% agarose gel, and stained with ... genotyping strategies in the rotavirus surveillance studies Materials and methods Sample collection Stool specimens were collected from patients who presented with diarrhea to the Dhaka and Matlab hospitals...
- 5
- 389
- 0
báo cáo hóa học: " Serum lipid profiles are associated with disability and MRI outcomes in multiple sclerosis" pptx
... clinical data acquisition, data analysis and interpretation and manuscript preparation RZ contributed to study design, MRI data acquisition, data interpretation and manuscript preparation EC contributed ... subset of patients who were not on statin treatment (results not shown) These results indicate that LDL, triglyceride and total cholesterol lipid profile variables are associated with disability ... http://www.jneuroinflammation.com/content/8/1/127 Table Demographic, clinical and MRI characteristics, and lipid profiles of patient subsets with and without statins Variable No Statins Statins p-value...
- 7
- 612
- 0
báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx
... measured with modified Rankin scale This negative correlation indicates that low ficolin-3 levels are associated with an unfavorable prognosis This association is most probably secondary to the negative ... observation that ficolin-3 has the highest concentration and the greatest complementactivating capacity among the lectin pathway initiators [45] Complement activation is one of the pathological ... for treatment of ischemic stroke either alone or in combination with antiinflammatory drugs The paper has some limitations First of all, the number of patients tested is rather low and no late follow-up...
- 27
- 434
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... by Rahman and his colleagues are indicated by ●; the four mutations plus others at the primer binding site by ❍; three out of the four mutations by ■, and three mutations plus others at the primer ... lineage IV (red) lected to understand this complex epidemiology [15] However, in recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes was the main cause of the ... G8, G9 and G10 rotavirus strains [7,12,17,20,21], and In order to evaluate how many G1 strains included in the GenBank database have these four specific mismatches and its clustering within specific...
- 4
- 329
- 0
báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx
... sequence http://www.virologyj.com/content/2/1/24 TTTAGTTAAGGCAAATAATA 3’ TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, ... amplification (30 sec at 94°C, 30 sec at 50°C, at 72°C), and a final extension of at 72°C in a thermal cycler (Eppendorf, Hamburg, AG) PCR products were run on a 2% agarose gel, and stained with ... genotyping strategies in the rotavirus surveillance studies Materials and methods Sample collection Stool specimens were collected from patients who presented with diarrhea to the Dhaka and Matlab hospitals...
- 5
- 355
- 0
báo cáo hóa học:" Decreased levels of serum glutathione peroxidase 3 are associated with papillary serous ovarian cancer and disease progression" pot
... addition, we demonstrate that serum levels are also decreased in women with recurrent disease and the stage-dependent decreases are more pronounced when patients and controls are stratified to include ... correlated with stage with an even greater statistical significance than that seen in Table p-values indicating statistically significant differences are shown in bold the serum of women with ... analyzed data CC designed and implemented experiments SS recruited, collected and annotated specimens, and interpreted data KO recruited, collected and annotated specimens, and interpreted data SC...
- 8
- 439
- 0
Báo cáo lâm nghiệp: " Crown architecture and leaf habit are associated with intrinsically different light-harvesting efficiencies in Quercus seedlings from contrasting environments" ppt
... that could be associated with different developmental patterns in this phylogenetically homogeneous but ecologically heterogeneous group of species It is expected that contrasting morphologies are ... size and total foliage area, thick leaves, high leaf mass per area, and other features are associated to plant species from hot and dry environments These traits have been considered as adaptations ... species studied differed markedly on their pattern of leaf emergence Whether these developmental patterns are associated with other architectural features and how they specifically influence light...
- 8
- 434
- 0
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc
... angiogenesis VEGF is involved in several steps of physiological and pathological angiogenesis including proliferation, survival and migration of endothelial cells The biological effects of VEGF are ... VEGF and bFGF and an increase of the angiostatic factor endostatin contribute to the impaired angiogenesis in patients with SSc, and whether these factors may correlate with the main clinical features ... inhibitors, clebopride and topical glyceryl trinitrate Patients with pre-SSc were treated with calcium channel blockers and topical glyceryl trinitrate All patients had received therapy with intravenous...
- 10
- 432
- 0
Báo cáo khoa học: "Phospho-ERK and AKT status, but not KRAS mutation status, are associated with outcomes in rectal cancer treated with chemoradiotherapy" ppt
... (8.7%) and not associated with p-ERK status [14] We did not examine the association between mutation location and p-ERK in our study Preoperative sample limitations prevented all phosphorylation and ... respectively) p-ERK activation is associated with survival, but not pAKT AKT activation status, but not ERK activation status, correlates with KRAS mutation status We lastly hypothesized that either p-ERK ... ERK and AKT are both potential targets of activated/mutated KRAS, we explored correlations between KRAS mutation and phosphorylation status of these molecules Representative examples of low and...
- 9
- 259
- 0
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx
... Medicine, the nurses and physician assistants at the Department of Gastroenterology, the research nurses at the Department of Rheumatology and Clinical Immunology, and the coders and archivists of ... infrequent and long-term complications and side effects Therefore, to determine the characteristics of patients who are especially at risk for serious NSAID ulcer complications and to compare the ... international normalized ratio (INR) at presentation was 4.87 ± 1.41 (mean ± SD) but the mean haemoglobin level at presentation did not differ from that in patients not taking coumarin, and neither...
- 8
- 459
- 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
... pronounced as that seen in the probands (P = 0.0009 for relatives as compared with probands), it achieved statistical significance for both parent and sibling subpopulations when compared with control ... observation that first-degree relatives of lupus patients have an increased prevalence of ANAs and other lupus -associated autoantibodies as compared with the general population [10,11], and these ... first-degree relatives is independently and additively associated with positive ANA status and autoimmune disease strongly suggests that this reduction is of immunopathogenic and not just statistical...
- 13
- 451
- 0
báo cáo khoa học: " Polymorphisms in the SULF1 gene are associated with early age of onset and survival of ovarian cancer" ppsx
... lesion that was histopathologically confirmed by a biopsy Information about the date of last contact and status of patients at the last contact was obtained from the M D Anderson Tumor Registry and ... EM, Baergen R: Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a Gynecologic Oncology Group study ... disease with 102 patients (75.6%) diagnosed at stage III and 22 patients (16.3%) diagnosed at stage IV Most patients had high grade (127, 95.5%) and serous cell type (109, 80.2%), and 85 patients...
- 7
- 355
- 0
Báo cáo y học: " The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages" doc
... modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages Journal of Inflammation 2010 7:3 Publish with Bio Med Central and ... treatment with 10 mg/ml proteinase K for h at 45°C DNA was extracted with phenol/chloroform and precipitated with ethanol Pellets were resuspended in TE buffer and subjected to PCR amplification ... involve the NFkB pathway signaling Interestingly, IkB phosphorylation and degradation and NFkB nuclear translocalization in LPS-stimulated macrophages were affected by AS101 treatment at different...
- 8
- 581
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25