0

special case intussusception with a known lead point mass

Báo cáo hóa học:

Báo cáo hóa học: " Structural Analysis of Single-Point Mutations Given an RNA Sequence: A Case Study with RNAMute" potx

Báo cáo khoa học

... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGG A GCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU U A GGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC ... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUC C GGGGCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ... CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGG A AGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGGU G GCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC...
  • 7
  • 317
  • 0
Báo cáo y học:

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Y học thưởng thức

... investigated, and the operation will be planned with as little trauma as possible, in order to preserve the hard and soft surrounding structures Clinical case A 30 years old Caucasian patient came ... patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...
  • 7
  • 597
  • 0
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP

Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP

Môi trường

... important to achieve the entire functions of operation control and administration In some WWTPs, wastewater analytical apparatuses and data transferring equipments are collocated sufficiently with ... conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, cleaned on time and calibrated periodically, to guarantee ... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic...
  • 9
  • 675
  • 0
Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx

Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx

Sức khỏe giới tính

... about cancer and Hiv & Aids and I like the game because it teaches about aids, cancer and malaria that those things killers and that shows us that our life are important and that you must take care ... and integrating the three clusters of key variables – learning, learner, and instructional game design” Such a position favours a ‘games as tutors’ approach: the technological artifact acts as ... collective game design, a learning with approach, technology acts as a cognitive tool and this leads to meaningful learning Just as collaborative design supports learning, so too is social collaborative...
  • 20
  • 452
  • 0
CASE STUDY OF COST SAVINGS WITH A NEW CHEMICAL MIXING SYSTEM AT MITSUBISHI PAPER HACHINOHE MILL PM7 potx

CASE STUDY OF COST SAVINGS WITH A NEW CHEMICAL MIXING SYSTEM AT MITSUBISHI PAPER HACHINOHE MILL PM7 potx

Tự động hóa

... C-PAM + AKD after machine screen 40sec Drainage 60sec Agitator setting High shear Medium shear Low shear A- PAM after machine screen (*) Tested at Mütec DFS retention analyzer Result of laboratory ... Installation in October, 2008 Conclusion of installation in PM7 for CPAM & AKD ÜResults: PM7, additive savings after flash injection installed also for CPAM and AKD Filler content CPAM APAM AKD ... Cleaner C-PAM MS P P CFP MFP Concept of laboratory test Simulation of conventional mixing points C-PAM before cleaner fan pump Simulation of new chemical mixing points C-PAM before A- PAM after machine...
  • 50
  • 435
  • 0
teaching music to students with special needs [electronic resource] a label free approach

teaching music to students with special needs [electronic resource] a label free approach

Đại cương

... concepts of a team approach to teaching as well as the idea that “fair is not always equal” is made apparent in these chapters All three chapters provide useful strategies not only for special learners ... City Nairobi New Delhi Shanghai Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland ... between special and regular (music included) education teachers There is always a demand for special educators because of the stresses involved with special education Funding of Special Education: A...
  • 261
  • 711
  • 0
báo cáo hóa học:

báo cáo hóa học: " Differential aspects of stroke and congestive heart failure in quality of life reduction: a case series with three comparison groups" pot

Hóa học - Dầu khí

... conceived and carried out the study, and participated in the data analysis, drafting IM participated in the acquisition of data for EQ-5D and mBI, and database management JLBP participated in the acquisition ... the Brazilian National Research Committee (CNPq) Author details Stroke Clinic of the Federal University of Bahia, Ambulatório Magalhães Neto, Rua Padre Feijó 240 Canela, Bahia, Brazil 2Bahiana School ... socio-demographic data such as age, sex, educational level and work status The mBI is a 50 -point scale that was applied to quantify impairment in activities of daily living such as grooming, walking, transferring,...
  • 5
  • 359
  • 0
Báo cáo toán học:

Báo cáo toán học: " Random approximation with weak contraction random operators and a random fixed point theorem for nonexpansive random self-mappings" pptx

Toán học

... separable Banach space which admits a weakly sequentially continuous duality mapping, the sufficient and necessary conditions that nonexpansive random self-mapping has a random fixed point are obtained ... Random fixed point theorems with an application to random differential equations in Banach spaces J Math Anal Appl 67, 261–273 (1979) Bharucha-Reid, AT: Random Integral Equations Academic Press, ... Convergence of an iteration leading to a solution of a random operator equation J Appl Math Stochastic Anal 12, 161–168 (1999) 12 Song, YS, Yang, CS: Solving variational inequality with weak contraction...
  • 14
  • 346
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Some fixed point-type results for a class of extended cyclic self-mappings with a more general contractive condition" pdf

Hóa học - Dầu khí

... equality defining a circle Aa1 for a fixed a1 = a1 (x0, y0) ≤ a- a’ is defined below together with available point- dependent lower and upperbounds: De la Sen and Agarwal Fixed Point Theory and Applications ... 0 a (1 − α1 ) > − α1 and ® AA with >a ≥ 0, β1 = a0 a ≥ a1 ≥ a − A1 ∪ A2 a β1 = > It is noted that the condition (3.1) is not guarana0 − α1 teed to be contractive for any point of A1 It is also ... Harjani, J, Lopez, B, Sadarangani, K: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space Abstr Appl Anal 2010, (2010) (Article...
  • 14
  • 418
  • 0
báo cáo hóa học:

báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx

Hóa học - Dầu khí

... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers ... Scholtz [9] from a GLRT approach under a Gaussian noise assumption and assuming the total noise covariance matrix and the useful propagation channel are two unknown parameters The advantages of this ... without a TNAR We assume in this section that parameters µs, φs, R, C and s are unknown and that no TNAR is available Under both these assumptions and A1 , A2 , matrices R and C may be estimated from...
  • 45
  • 467
  • 0
báo cáo hóa học:

báo cáo hóa học:" Existence of positive solutions for fourth-order semipositone multi-point boundary value problems with a sign-changing nonlinear term" docx

Hóa học - Dầu khí

... multi -point boundary value problems with a sign-changing nonlinear term Yan Sun Department of Mathematics, Shanghai Normal University, Shanghai 200234, People’s Republic of China Email addresses: ... problem at resonance Nonlinear Anal 24(10), 1483–1489 (1995) [5] Gupta, CP, Ntouyas, SK, Tsamatos, P: On an m -point boundary value problem for second-order ordinary differential equations Nonlinear Anal ... [7] Gupta, CP: Solvability of a three -point nonlinear boundary value problems for a second order ordinary differential equation J Math Anal Appl 168, 540–551 (1992) 23 [8] Gupta, CP: A sharp condition...
  • 25
  • 221
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Robust Linear MIMO in the Downlink: A Worst-Case Optimization with Ellipsoidal Uncertainty " pptx

Hóa học - Dầu khí

... Telatar, “Capacity of multi-antenna Gaussian channels,” Tech Rep., AT & T Bell Labs, Murray Hill, NJ, USA, 1995 [4] V Tarokh, N Seshadri, and A R Calderbank, “Space-time codes for high data rate ... communications through MIMO channels, Ph.D dissertation, Technical University of Catalonia, Barcelona, Spain, May 2003 [27] A Pascual-Iserte, D P Palomar, A I P´ rez-Neira, and e ´ M A Lagunas, A ... Technical University of Catalonia, Barcelona, Spain, February 2007 ´ ´ [33] M Payaro, A Pascual-Iserte, and M A Lagunas, “Robust power allocation designs for multiuser and multiantenna downlink...
  • 15
  • 290
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Báo cáo khoa học

... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... Polish Acad Sci Math 51 (2003), no 2, 147–156 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean vector spaces, Proc Amer Math Soc 118 (1993), no 3, 819–821 S Prieß-Crampe, Der Banachsche ... statements are equivalent Jacek Jachymski 33 (i) There exists a sequence (Rn )∞ of equivalence relations in X such that the assumpn= tions of ET are satisfied (ii) There exists a non-Archimedean...
  • 6
  • 268
  • 0
Engineering Concepts in Industrial Product Design With A Case Study of Bicycle Design

Engineering Concepts in Industrial Product Design With A Case Study of Bicycle Design

Kỹ thuật

... kullanılan tasarım metotları ve bunların tasarım aktivitesi sürecindeki avantajları da konunun daha net bir şekilde a ıklanabilmesi amacı ile belirlenmiştir Bu çalışma, tasarım sistemleri alanının ... doğrultuda, endüstri ürünleri tasarımı alanının bazı mühendislik alanları ile birlikte, tasarım problemlerine ve araçlarına yaklaşımlarının karşılaştırılması gösterilmiştir Ayrıca, mühendislikte kullanılan ... transportation area, etc Any area reveals a diversity that contains a variety of objects to facilitate particular activities All will have been conceived to serve a certain purpose and embody a particular...
  • 167
  • 347
  • 0
báo cáo khoa học:

báo cáo khoa học: "Primary malignant mixed müllerian tumor of the peritoneum a case report with review of the literature" doc

Báo cáo khoa học

... Primary peritoneal carcinosarcoma (malignant mixed Müllerian tumor): Report of a case with five-year disease free survival after surgery and chemoradiation and a review of literature Acta Oncologica ... Takeda A, Fukami H, Yamada C, Matsuyama M: Characteristics of cell lines established from mixed mesodermal tumor of the human ovary: carcinomatous cells are changeable to sarcomatous cells Cancer ... chemotherapy and irradiation with various survival outcomes Ko et al [19] reported on a patient that was treated with optimal tumor debulking and a combination of chemotherapy with Ifosfamide and...
  • 4
  • 461
  • 0
báo cáo khoa học:

báo cáo khoa học: "Primary sarcoma of the pancreas, a rare histopathological entity. A case report with review of literature" pps

Báo cáo khoa học

... Discussion Sarcomas of the pancreas are exceedingly rare Baylor et al reported a 0.1% incidence of pancreatic sarcoma after review 5000 cases of pancreatic cancer [1] Amongst pancreatic sarcomas leiomyosarcomas ... warrant palliation Potts et al proved the importance of a palliative gastric bypass in advanced stages [9] In this case, the patient presented with an advanced tumor, so curative resection was ... young, was diagnosed with a sarcoma of the pancreatic caput Clinically patients present with colicky pain, nausea and vomiting These findings are basically similar to those of other pancreatic pathologies...
  • 4
  • 694
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A colliding maxillary sinus cancer of adenosquamous carcinoma and small cell neuroendocrine carcinoma - a case report with EGFR copy number analysis" pot

Báo cáo khoa học

... 83:530-532 Alos L, Castillo M, Nadal A, Caballero M, Mallofre C, Palacin A, Cardesa A: Adenosquamous Carcinoma of the head and neck: criteria for diagnosis in a study of 12 cases Histopathology ... 15:264-278 Mineta H, Miura K, Takebayashi S, Araki K, Ueda Y, Harada H, Misawa K: Immunohistochemical analysis of small cell carcinoma of the head and neck: a report of four patients and a review of ... nasopharyngeal carcinoma, and undifferentiated sinonasal carcinoma SNEC has been reported to stain strongly with synaptophysin and CD56 nerve cell adhesion molecule and weakly with chromogranin A and...
  • 5
  • 342
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

Báo cáo khoa học

... colon cancer shortly after diagnosis at age 55, and three other paternal family members had cancer in an unknown site The patient's paternal grandmother died at an early age of unknown causes ... cisplatin and taxol combined with radiotherapy, and is disease-free at the time of publication A comprehensive family history was taken and a formal pedigree was assembled (Fig 2) The patient's father ... 23:6524-6532 Radtke F, Clevers H: Self-renewal and cancer of the gut: Two sides of a coin Science 2005, 307:1904-1909 Aarnio M, Sankila R, Pukkala E, Salovaara R, Aaltonen LA, de la Chapelle A, Peltomäki...
  • 6
  • 480
  • 0
Báo cáo y học:

Báo cáo y học: "Disease-modifying antirheumatic drugs are associated with a reduced risk for cardiovascular disease in patients with rheumatoid arthritis: a case control study" doc

Báo cáo khoa học

... infarction, a coronary artery by-pass graft procedure, a percutaneous transluminal coronary angioplasty or ischemic abnormalities on ECG Cerebral arterial disease was defined as a history of cerebral vascular ... vascular accident (confirmed by a neurologist), a transient ischemic attack or a carotid endarterectomy Peripheral arterial disease included an aneurysm of the thoracic and/or abdominalis aorta, a ... Chicago, IL, USA) Results Rheumatoid arthritis patients with and without cardiovascular disease The baseline characteristics of the RA patients with and without CVD in our study population are...
  • 6
  • 445
  • 0
Báo cáo y học:

Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

Báo cáo khoa học

... elderly cases Statistical results In univariate analysis, cases and controls differ significantly with regard to body mass index, smoking habits, marital status, medical history of heart failure, ... of the univariate or multivariate analyses Table Multivariate analysis of significant variables and other likely causational variables for serious NSAID ulcer complications Predictor Adjusted OR ... of cases and controls JvdP also contributed to the statistical analysis of the data All authors read and approved the final manuscript Acknowledgements The authors wish to thank all participating...
  • 8
  • 459
  • 0

Xem thêm

Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008