soil erosion assessment using universal soil loss equation usle and spatial technologies— a case study at xiushui watershed china
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... there are two influential views: traditional view and alternative view They thought that traditional view was inappropriate and inadequate because the listener was regarded as a tape-recorder and ... responding (collaborative orientation); and, creating meaning through involvement, imagination and empathy (transformative orientation) Howatt and Dakin (1974) suggested that listening is the ability ... identify and understand what others are saying This involves understanding a speaker's accent or pronunciation, his grammar and his vocabulary, and grasping his meaning An able listener is a person...
- 99
- 805
- 0
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc
... of Patient A and B was 42 and 58, respectively The scores indicate that the Patients need for maximal or moderate assistance for achieving an adequate performance of ADL As the common clinical ... Patient A and B were 15 and points, respectively The behavioral neglect of Patient A was categorized moderate and Patient B was categorized as a mild level According to the motion analysis of head ... unilateral spatial neglect, and the egocentric frame of reference NeuroImage 2003, 20:75-81 Karnath HO: Spatial orientation and the representation of space with parietal lobe lesions Philosophical...
- 8
- 538
- 0
landslide hazard and risk assessment for road network using rs and gis a case study of xin man district, vietnam
... Independent data layers(categorical) DATA INTEGRATION Geological map Landslides map Lineament map Landslides map Elevation map Landslides map Slope map Landslides map Drainage map Landslides map Distance ... Shu Yuan and Mohd Ibrahim (1997) In this study, land surface temperate and landuse information have been derived from Landsat thematic Mapper data The elevation and slope inclination have been ... Diagram For Landcover Map extracted From Satellite Data 37 Flow Diagram for Buffered Road and lineament Maps 38 Methodology of thematic data layer preparation 39 Show the landslide attacked road...
- 142
- 465
- 1
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... brand identity such as: • Brand identity is a unique set of brand associations that the brand strategist aspires to create or maintain These associations represent what the brand stands for and ... the brand? What are the fundamental beliefs and values that drive the brand? What are the competencies of the organization behind the brand? What does the organization behind the brand stand for? ... skilled and specialized discipline It concerns with managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations...
- 67
- 974
- 0
Ecological Assessment of Water Quality by Three-species Acute Toxicity Test and GC/MS Analysis - A Case Study of Agricultural Drains
... sampling sites (Kanagawa Prefecture, Japan) Preparation of Samples for Analysis All water samples were filtrated using a μm glass fiber filter, and then concentrated by solid-phase extraction (SPE) ... inhibition ratio for algae, immobilization ratio for daphnia, and mortality ratio for fish) of river water samples are shown in Fig (a) , (b), and (c) respectively In total, 149 data were obtained from ... decontamination in composting oily waste, Ecotoxicol Environ Saf., 47, 156-166 Liu R., Kameya T., Sawai A and Urano K (2007) Application of a larval medaka assay to evaluate the fish safety level...
- 8
- 667
- 0
Digital Sound Recorder: A case study on designing embedded systems using the UML notation.
... cycleDay( ) cycleMonth( ) cycleYear( ) Today Figure 3.9: Alarm clock class diagram The Alarm Clock Class Diagram The Alarm Clock class keeps the current time and date and the alarm time The Alarm ... is created, it allocates and array of Audio Blocks Each element of the array is marked when used and contains a pointer to the next block into a message stream We avoid memory fragmentation by ... AlarmMenu Update(Up)? Update(Down)? SetAlarmTimeOption SetClockOption Update(Up)? Update(Left)? Update(Down)? Update(Down)? SetAlarmOnOption Update(Up)? Update(Rigth)?/ SetAlarm(On)? Update(Rigth)?...
- 37
- 589
- 0
Tài liệu Environmental Assessment of Estuarine Ecosystems A Case Study pdf
... urbanization and industrialization As a consequence, sites that are potentially available for use as controls have a number of natural characteristics that may differ from Table 1.1 Characterization ... invertebrates, and this is of great ecological importance because of the hazard at the population level (Arslan and Parlak 2007; Arslan et al 2007) Metabolites of APs are hydrophobic and thus ... to acquire chemical and biological data precisely at the same place and at the same moment, taking into account temporal changes within each year and between successive years In addition, it was...
- 370
- 393
- 0
An Assessment of the Environmental Implications of Oil and Gas Production: A Regional Case Study pot
... oil and gas production, both on a national basis and for Region specifically Appendix C summarizes our assessment of available data sources, data limitations, and data gaps Using the best available ... gas lease and plant, extrapolated 2002 to 2006 using the EIA national estimate of natural gas lease and plant Data sources: FRB, EIA Used Lasser and IHS produced water estimates for 2006 Extrapolated ... Columbia and Manitoba forged an agreement establishing the initiative Since that time, Montana and Utah have also signed on as participants, and Alaska, Colorado, Idaho, Nevada, and Wyoming are...
- 115
- 744
- 0
Báo cáo khoa học: "Opinion Mining Using Econometrics: A Case Study on Reputation Systems" pdf
... worst case they ignore text data altogether In computational linguistics, researchers often rely on human annotators to generate training data, a laborious and errorprone task We believe that cross-fertilization ... and level of experience into account, and also highlight the additional the value contained in textbased reputation The examples that we list here illustrate that our technique generates a natural ... data set contains details of the transactions that took place on the marketplace of Amazon.com for each of the software titles The Amazon Web Services associates a unique transaction ID for each...
- 8
- 440
- 0
assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study
... Neuber and Glinka and also using the simulations by finite element method for plane stress and plane strain states The results are presented in Tab (1) and (2) for Al alloy 7050 T7451 and Man-Ten ... 1985) 3 Materials and Methods 3.1 Specimen Characteristics Plates with circular holes are elements which appear frequently in structural applications, especially in the naval and aeronautic industry ... and loading apparatus The system was prepared for analysis in dark field using circular polarized light with incident white light Several levels of loading were uniaxially applied The material...
- 9
- 410
- 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... ACCTCTGCCTAATCATCTC ACTGTTCAAGCCTCCAAGCTGTGCCTTGG GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA ... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG...
- 7
- 404
- 0
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
... ACCTCTGCCTAATCATCTC ACTGTTCAAGCCTCCAAGCTGTGCCTTGG GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA ... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG...
- 7
- 566
- 0
báo cáo khoa học: "The relationship between baseline Organizational Readiness to Change Assessment subscale scores and implementation of hepatitis prevention services in substance use disorders treatment clinics: a case study" pdf
... intake, adding hepatitis B and C testing to the routine testing panel may be a relatively easy change in practice compared to negotiating the availability and administration of hepatitis A and B vaccinations ... patients Appear to have more advantages than disadvantages for VA patients Context Leadership Culture Senior leadership/clinical management in your organization: Reward clinical innovation and creativity ... construct of organizational readiness to change, an organization may have all of the necessary financial and material resources to implement a change but lack the motivation or the capability to mobilize...
- 12
- 411
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... information system This data are routinely collected and ascribed to the primary care practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... interventions appears to vary across different clinical problems, contexts, and organisations This study demonstrated that a theory-based process evaluation can provide useful information on causal mechanisms...
- 9
- 367
- 0
Báo cáo y học: "Benign gastro-colic fistula in a woman presenting with weight loss and intermittent vomiting: a case report" pps
... vomiting, diarrhea and approximately 20 kilogram weight loss She denied any hematemesis, melena or fever At presentation our patient was frail and emaciated Regarding clinical examination, there ... medication On this occasion, gastroscopy revealed a deep ulcer of the greater curve of the stomach that appeared to penetrate the muscular layer and was highly suspicious of a fistula The pathological ... there have been very few recent studies and advances in surgical techniques and post-operative care as well as nutritional optimization suggest empirically that prognosis may have improved Case...
- 3
- 363
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Development of Buffalo Hump in the course of antiretroviral therapy including raltegravir and unboosted atazanavir: a case report and review of the literature" pot
... disorder and could constitute a background that contributes to the final appearance of buffalo hump after raltegravir plus atazanavir treatment Current data indicate that the etiology of HIV-associated ... the literature available to date regarding such a combination There are no publications today that describe a relationship between RAL and unboosted ATV therapy and the occurrence of Buffalo Hump ... to stavudine, lamivudine and nevirapine because of an episode of acute renal colic Our patient attended outpatient clinics on a regular basis, and was found to have a good immunological and virological...
- 4
- 408
- 0
Báo cáo y học: " Solitary metastatic adenocarcinoma of the sternum treated by total sternectomy and chest wall reconstruction using a Gore-Tex patch and myocutaneous flap: a case report" docx
... was attributed to the drainage of the internal mammary nodes into the subclavian vein Moreover, Park and Tarver reported cases of solitary sternal metastasis from breast carcinoma that was treated ... (cyclophosphamide, epirubin and fluorouracil) chemotherapy and radiotherapy The clinical and histological characteristics of the primary breast cancer revealed a Stage IIIa adenocarcinoma with positive axillary ... invading the chest wall Myocutaneous flaps and prosthetic materials greatly facilitate reconstruction after massive chest wall resection Case presentation We report the case of a 70-year old Caucasian...
- 8
- 539
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25