showing text and a value in a cell
Báo cáo khoa học: Recombinant bovine zona pellucida glycoproteins ZP3 and ZP4 coexpressed in Sf9 cells form a sperm-binding active hetero-complex ppt
... (lane in each panel) The rZP3 and rZP3FLAG bands are indicated by arrowheads in (A) , (B), and (C) The rZP4 band is indicated by an arrow in (A) and (B) The ZP4182)464 band is indicated by an asterisk ... were also recognized by GNA and LCA Molecular mass markers are indicated in kDa on the left of each panel candatus agglutinin (ACA) (data not shown) In contrast, all tested lectins recognized native ... biotin-conjugated lectins were PHA-L4, ACA, and GNA ACA and GNA were purchased from EY Laboratories (San Mateo, CA, USA), and the remaining lectins were from Seikagaku Kogyo For the peroxidase-conjugated...
- 16
- 346
- 0
Báo cáo y học: "LMP-420, a small-molecule inhibitor of TNF-alpha, reduces replication of HIV-1 and Mycobacterium tuberculosis in human cell" pps
... release intracellular bacteria At all time points an aliquot of un-lysed, infected cells was harvested and counted, allowing an exact quantification of cells as well as determination of cell viability ... (containing 5% heat-inactivated human AB serum) and 0.4 ml of cell suspension put into each well of a 48-well tissue culture plate To each well was added 0.1 ml of media or media containing LMP-420 ... LMP-420 inhibits replication of M Tb in human alveolar macFigure rophages (AM) LMP-420 inhibits replication of M Tb in human alveolar macrophages (AM) AM were collected by bronchial-alveolar lavage...
- 9
- 404
- 0
A novel membrane pool of protein kinase c and its role in mammalian cell signaling
... extracellular ligand-binding domain and an intracellular catalytic or enzyme-binding domain The great majority of the receptors are themselves protein kinases or are associated with kinases Binding ... one contains almost the entire extracellular domain and the other contains a short ectodomain stub followed by a transmembrane domain and a long cytoplasmic tail After ligand binding, a change occurs ... Ca2+-sensitive manner, and to that of skeletal muscle type α-actinin in a Ca2+-insensitive manner PI-4,5P2 regulates the F-actingelating activity of α-actinin in vitro, and also activates the protein kinase...
- 221
- 308
- 0
Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc
... 208 and 553 to 582 of the CTMP-7 gene respectively: 5'-GGATCCCGCAGGCCAAAGACAACAATAGT GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAAACTAGTTACCAGATCATAACAACCCTCA AGAGGGTTGTTATGATCTGGTAACTAGTTTCA ... and pGE-Neg (Fig. 5a) At 24 h post-infection, the viral load in control cell supernatants was significantly higher than the intracellular viral load In contrast, the intracellular viral load in ... dropout agar plates lacking leucine, tryptophan, histidine and adenine (QDO) and were cloned and sequenced The β-galactosidase assay was performed to compare the relative strength of interaction...
- 12
- 302
- 0
Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf
... catalase and bovine intestine alkaline phosphatase), phenyl–agarose, lectin-free Sepharose 4B and agarosebound concanavalin A, LCA, RCA, DNase I, ethidium bromide and DNA size markers were all ... 5¢-alternative acetylcholinesterase mRNAs have been identified in mice and three in humans [11,12], and acetylcholinesterase-H, 4520 acetylcholinesterase-T and acetylcholinesterase-R mRNAs starting ... Statistical analysis The results are expressed as mean ± standard deviation Statistical differences in cholinesterase activity between nor- Cholinesterases in renal carcinomas mal and malignant kidney...
- 11
- 474
- 0
Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt
... domains involved in localization A B C D Fig Effects of mutations in Lsm8p on its nuclear localization (A) Lsm8p C-terminal domain mutations (B) Lsm8p N-terminal domain mutations and recombinant ... the former and a higher level of nuclear accumulation for the latter, indicating that in the absence of an N-terminal domain distinct localization is lacking Finally, the Lsm1p Sm domain by itself ... involved in intersubunit and protein–RNA contacts [29,33,34] Crystal structures and cross-linking data have shown that RNA-binding residues in Sm(-like) proteins are located in loop (between b2 and...
- 16
- 515
- 0
Báo cáo khoa học: Suppression of microtubule dynamics by benomyl decreases tension across kinetochore pairs and induces apoptosis in cancer cells potx
... of the caspases Caspases initiate the apoptotic DNA fragmentation by activating certain nucleases [50] The 116 kDa enzyme PARP is cleaved into a 85 kDa fragment and a 25 kDa fragment in many forms ... cytoskeletal polymers which are present in all eukaryotic cells that play important roles in various cellular processes such as cell signaling, cell motility, organelle transport and maintenance of cell ... monoclonal antibcl2 IgG, mouse monoclonal antia-tubulin IgG, affinity isolated rabbit antic-tubulin IgG, alkaline phosphatase-conjugated antimouse IgG, alkaline phosphatase-conjugated antirabbit...
- 15
- 333
- 0
Risk Management and Shareholders’ Value in Banking pdf
... on assets (rA ) and total financial liabilities (FL) and average interest rate on liabilities (rL ) respectively Using NSA and NSL as financial assets and 10 Risk Management and Shareholders’ Value ... earned and paid by the bank, along with a slump in the market value of fixed-rate assets and liabilities.1 Usually such a change also causes a decline in demand liabilities and call loans In effect, ... financing 20 Risk Management and Shareholders’ Value in Banking (and again, if this request is not granted, they may pay back their loans and turn to another bank) In practice, empirical analysis...
- 811
- 6,780
- 26
Risk Management and Shareholders’ Value in Banking ppt
... on assets (rA ) and total financial liabilities (FL) and average interest rate on liabilities (rL ) respectively Using NSA and NSL as financial assets and 10 Risk Management and Shareholders’ Value ... earned and paid by the bank, along with a slump in the market value of fixed-rate assets and liabilities.1 Usually such a change also causes a decline in demand liabilities and call loans In effect, ... financing 20 Risk Management and Shareholders’ Value in Banking (and again, if this request is not granted, they may pay back their loans and turn to another bank) In practice, empirical analysis...
- 811
- 2,217
- 0
Báo cáo lâm nghiệp: "Changes in phenolic acids and stilbenes induced in embryogenic cell cultures of Norway spruce by two fractions of Sirococcus strobilinus mycelia" pot
... Progress in basic understanding and practical application Advances in Botanical Research, 30: 291–328 Khan W., Prithiviraj B., Smith D.L (2003): Chitosan and chitin oligomers increase phenylalanine ammonia-lyase ... using bovine serum albumin as a standard The final protein content of the intracellular fraction in 100 ml of liquid medium was mg Preparation of mycelial wall fraction The mycelial cell wall ... isorhapontin (iRHAP), astringin (ASTR) and piceid (PIC), determined in Norway spruce cell cultures treated with 5% and 20% A abietina culture filtrate and from the control cells (C) Means of two independent...
- 7
- 506
- 0
Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps
... 5'-GGTGGCAGAACTTGAAGGGTTA-3' (forward) and 5'-GGGCAACACACACAGGAAATC-3' (reverse); L-SOX5, 5'-GAATGTGATGGGACTGCTTATGTAGA-3' (forward) and 5'-GCATTTATTTGTACAGGCCCTACAA-3' (reverse); SOX6, 5'CACCAGATATCGACAGAGTGGTCTT-3' ... 5'CGGTTTGCCAGGAGCTATAGG-3' (forward) and 5'TCTCGGCCATTTTTCCCATA-3' (reverse); COL1 0A1 , 5'TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAGTACAGTGCATAAATAAATAATATATCTCCA-3' (reverse); COL1 1A2 , 5'-CCTGAGCCACTGAGTATGTTCATT-3' ... 5'CACCAGATATCGACAGAGTGGTCTT-3' (forward) and 5'CAGGGTTAAAGGCAAAGGGATAA-3' (reverse); SOX9, 5'CTTTGGTTTGTGTTCGTGTTTTG-3' (forward) and 5'-AGAGAAAGAAAAAGGGAAAGGTAAGTTT-3' (reverse); versican, 5'-TGCTAAAGGCTGCGAATGG-3'...
- 9
- 307
- 0
Báo cáo y học: " Basal core promoters control the equilibrium between negative cofactor 2 and preinitiation complexes in human cells" pdf
... Fukuda S, KanamoriKatayama M, Kitazume Y, Kawaji H, Kai C, Nakamura M, Konno H, Nakano K, Mottagui-Tabar S, Arner P, Chesi A, Gustincich S, Persichetti F, et al: Genome-wide analysis of mammalian ... linker (of oligo-25, 5’-GCGGTGACCCGGGAGATCTGAATTC, and oligo11, 5’-GAATTCAGATC) using T4 DNA ligase (New England Biolabs) overnight at 16°C DNA was ethanol precipitated and amplified by ligation-mediated ... 43 Carninci P, Sandelin A, Lenhard B, Katayama S, Shimokawa K, Ponjavic J, Semple CA, Taylor MS, Engstrom PG, Frith MC, Forrest AR, Alkema WB, Tan SL, Plessy C, Kodzius R, Ravasi T, Kasukawa T,...
- 14
- 284
- 0
báo cáo khoa học: " Human Papillomaviruses, 16INK4a and Akt expression in basal cell carcinoma" potx
... haematoxylin Magnification A (20X) and B (10X) Figure Immunostaining patterns of pAkt and Akt2 Cytoplasmic and nuclear stain for pAkt (A) in keratinocytes of BCC and mostly nuclear stain for Akt2 ... participated in the data acquisition and in clinical analysis; PF participated in the data acquisition and in clinical analysis; RC participated in the study design; CC participated in the study design and ... Human Papillomaviruses, 16INK 4a and Akt expression in basal cell carcinoma Francesca Paolini1*, Angelo Carbone1*, Maria Benevolo2, Vitaliano Silipo3, Francesca Rollo2, Renato Covello2, Paolo...
- 24
- 287
- 0
Báo cáo y học: "Nipah virus infection and glycoprotein targeting in endothelial cells" ppsx
... cells causes syncytia formation and increases transendothelial permeability Primary brain capillary endothelial cells have the closest resemblance to brain endothelia in vivo and exhibit excellent ... proteins describing that polarized transport and also recognition of protein sorting signals are not necessarily the same in epithelial and endothelial cells and can thus not be predicted in advance ... experiments and helped to draft the manuscript AM designed the study, helped with the analysis and the interpretation of the data and drafted the manuscript All authors read and approved the final manuscript...
- 10
- 366
- 0
báo cáo khoa học: " Iron and ferritin accumulate in separate cellular locations in Phaseolus seeds" pdf
... G14519 (i and m), and P lunatus G25350 (j, k, l, n, o, and p) cotyledons were immunostained using antibodies raised against A thaliana ferritin1 (AtFER1) and Alexa 546 secondary antibodies In a, b, ... longitudinal section of bean embryonic axis showing PPB stain of the radicle provascular and meristematic tissue Scale bars in a: cm and b to u: mm antibodies detected two bands at approximately 28 kDa ... soaked in 70% ethanol for 24 hours prior to PPB staining Filled arrows point at iron stained cells and open arrows point at small iron stained spots am: amyloplasts, rad: radicles, pvb: provascular...
- 14
- 259
- 0
Báo cáo y học: "Biochemical and morphological changes in endothelial cells in response to hypoxic interstitial edema" pdf
... values with a significant increase in mean and median values (Table 5) cell surface distribution was shifted towards higher values and indeed the mean and median surface values were significantly ... (lyso-phospholipids and plasmalogens) that are implicated in the oxidantantioxidant phenomena and on lipid microdomains (caveolae and lipid rafts) Methods Chemical The reagents used (analytical grade) and HPTLC ... unsaturated fatty acids, was calculated as follows: ∑ saturated fatty acids/∑ unsaturated fatty acids, where ∑ unsaturated f .a is obtained by adding the percentage of each unsaturated fatty acid...
- 14
- 240
- 0
Báo cáo y học: " Binary gene induction and protein expression in individual cells" pptx
... author(s) declare that they have no competing interests Additional material Additional File This file contains parameter values for the model presented in the main text, and some additional simulation ... parameters The stochastic reactions and the values of the reaction parameters are listed in Table S1~S3 in the supporting material, where references and rationale for the choice of parameter values ... measurement, especially at an early stage of induction, protein molecules may not have accumulated to detectable levels In a histogram, these cells, although actively transcribing or having transcribed...
- 15
- 268
- 0
Báo cáo y học: "Global analysis of alternative splicing regulation by insulin and wingless signaling in Drosophila cells" ppt
... signaling pathways in Drosophila S2 cells Figure Activation of insulin and wingless signaling pathways in Drosophila S2 cells (a) Schematic representation of the insulin and wingless signal transduction ... previous analysis of transcriptional targets [48,49], and to allow RNA turnover and minimize indirect effects after insulin activation, total RNA was isolated hours after insulin treatment Activation ... Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artieri CG, Barbash DA, Barker...
- 14
- 271
- 0
qos and qoe managemaent in umts cellular systems
... Li and Renaud Cuny Espoo, Finland and Boston, Massachusetts, USA Abbreviations 16QAM 1G 2G 3G 3GPP 3GPP2 3GSM 8-PSK AAA AAL AB ABR AC ACK AD AF AF-AI AG AGCH AH AICH ALCAP AM AMC AMR AMR-WB ANSI ... Kimmo Valkealahti, Mikko Kylva¨ja¨, Massimo Barazzetta, Mariagrazia Squeo, Jaroslav Uher, Luca Allegri and Jaana Laiho 10.1 Service optimisation concept and architecture 10.1.1 Conceptual breakdown ... Jaroslav Uher, Heikki Almay, Noman Muhammad, Uwe Schwarz, Massimo Barazzetta, Martin Kristensson, Luis Alberto Pena Sierra, Mariagrazia Squeo, ˜ Mikko Kylvaja, Sandro Grech, Svetlana Chemiakina,...
- 483
- 221
- 0
Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells
... also associated with an increase in COX activity in cervical (HeLa) and lung carcinoma cells (A5 49) (Vijayasarathy, Biunno et al 1998; Campian, Gao et al 2007) 1.15 Concluding remarks: Existing ... manifestations and applications such as neurodegeneration, inflammation, aging, atherosclerosis, ischemia-reperfusion injury in cardiac tissues and chemotherapeutic effects (Waris and Ahsan 2006) Involvement ... shown to favor a cascade of survival signaling pathways in cancer cells (Steinman 1995; Clement and Stamenkovic 1996; Ahmad, Clement et al 2003; Clement, Hirpara et al 2003; Pervaiz and Clement...
- 78
- 267
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25